[1] Vaccines Projected to Cause 62.3 Million Cardiovascular Deaths in 2022 Worldwide
[2] Every 1% fall in vaccine efficiency is the result of a 0.5%-1% fall in your immune system capability
[3] The 19 Deceptions of Covid19 mRNA Vaccination
[4] The Billion Life Covid19 Fraud
[5] The Expose Guide to Vaccination Genetics
[6] PfizerGate: The Worldwide Cover Up of Vaccine Damage
[7]
Help The Truckers Finish Their Delivery of Canada
[8] Biochemical and Statistical Proof that Moderna Created Covid19
[9] How to stop Putin
[10] Impeach the Hidden US President for Getting No Votes in the 2020 Election
[11] Exhaustive Proof that Moderna made Covid19
[12] Hypersonic Nuclear Terrorism
[13] Pfizer BNT162b25.3.6 Cumulative Analysis of Post-authorization Adverse Event Reports
[14] Timeline of Bio-Terror
[15] Obama 46
[16] Asovstall versus Whitehall and Russia versus NATO
[17] The Hidden Goal of the Hidden Government of the World
[18] Exposing the Role of the State in the Uvalde Massacre
[19] The Woke Religion is the precise Opposite of Biblical Christianity
[20] A New Study Proves that Covid19 Immunity Does Not Wane At All - Not Even By 1%
[21] Flu shots are updated every year - Why aren't Covid shots?
[22] 12 things Liz Truss should do to fix the UK
[23] Did Covid Vaccines contribute to the deaths of Queen Elizabeth and Prince Philip?
[24] The Day Democracy Died in America - the 4 MAGA Martyrs
[25] Pfizer's New Vax Figures Prove the Old Vax had negative efficacy within 30 days
[26] The Age of Nuclear Imperialism has Begun
[27] The US Deep State Funded Daszak to Create Covid-19 for Moderna's Vaccine Platform
[28] How Formula One became Formula Fraud
[29] MHRA Confirms that Covid was man made
[30] The Genetic Mechanism by which the mRNA Jabs cause the Intravascular Growths in the DiedSuddenly Movie
[31] Don't Mention The War
[32] Government data show that the triply vaxxed are 35x more likely to be hospitalised with Covid-19 than the unvaxxed in NSW Australia
[33] VB Day for the UK will be 2023February12 (for under 50s)
[34] It is not Agenda 2030 - It is Agenda 2023
The recent American Heart Association Paper given in a speech by Dr Steven Gundry to the American Heart Association in Boston on November 12-14 found that mRNA vaccines more than double your 5 year chances of getting a heart attack as measured by various inflammatory markers at 2 months after the 2nd jab The expose covered this in their article on football deaths of December8.
We have also seen that on pitch footballer lethal cardiac incidences doubled every quarter in 2021
Let us be plain about what this means. These footballers are the canary in the coalmine of vaccination. Let us not permit their deaths to be for nothing. They get it first because they are pushing their hearts the hardest. It was so moving for me to watch Sergio Aguero, the totally fit Manchester City player, collapse, then struggle to stand up grabbing his heart with his colleagues around him thinking nothing can be wrong, I will just play on now, and then collapse again. He survived, but is no longer able to play professional football. It is totally absurd for such a fit young man. We must see these dead footballing canaries (31 from heart attacks last year). We must learn from this that the coalmine of vaccination is full of poison and we must get out of it immediately.
So putting the jigsaw together. We know that the heart attack risk is double in footresters (sedentary people), 2½ months after the 2nd jab. And we know that the pitch related heart attack risk in pro footballers was 4x normal in 2021 and that December 2021 with 7 deaths almost matched the previous 12 year average of 7.8 death per year. From this we can deduce that the risk to footballers is around twice the risk to footresters. But the risk to footballers doubles every quarter. therefore the risk to footresters will also double every quarter because they have all taken the same vaccine and they all have the same protein spikes inside them. It is just that footballers push their hearts harder than couch potatoes. So we take the Q4 risk to sedentary people to be 2x normal and extrapolate exponentially from there doubling the risk every quarter. This gives Q1/2/3/4 risks in 2022 of 4x/8x/16x/32x normal.
There have already been 6 footballer deaths in the first half of January 2022 among club players during matches or training sessions.
11 Jan 22 | Amir Abou Aiana | 18 | ![]() |
NONE | Collapsed to the ground with a cardiac arrest on the football pitch of the oratory of via Cellini in Cesano Boscone (hinterland West of Milan) . Resuscitation was attempted and an ambulance was called. He died shortly after arriving at hospital. News Story EXCLUDED (he was not professional due to a congenital heart dysfunction) |
11 Jan 22 | Mateo Hernandez | 18 | ![]() |
Dimurol Salesianos | Dimurol Salesianos Tenerife Football goalkeeper died suddenly and unexpectedly. News Story |
11 Jan 22 | Isaías | 17 | ![]() |
Flamengo de Piauí | Flamengo de Piauí Footballer in Teresina told his teammates as they ran that he felt discomfort. He slowed down, then walked to the bench, where he collapsed. Medics tried to resuscitate him, but he died. It was his third time training with the team. News Story News Story2 |
10 Jan 22 | Filip Turk | 22 | ![]() |
FC Zaprešić | Another young Croatian football player died suddenly, he was only 22 years old: ‘Good luck up there, somewhere among the stars. We will meet again … “ News Story News Story2 |
6 Jan 22 | Herbert Afayo | 21 | ![]() |
Lugazi Municipal Council FC | Collapsed with a cardiac arrest on the pitch at the Geregere Safi Playground in Lugazi, Buikwe District. He was resuscitated and taken to the local hospital but died before reaching the hospital. A postmortem concluded the cause was cardiac arrest. He suffered a bout of malaria weeks before the match (but that is very common in Africa). News Story |
5 Jan 22 | Oisin Fields | 30 | ![]() |
Navan Harps FC | Collapsed and died while playing football with his friends and his death has sent shockwaves across his local community. News Story In a brief statement, officials said: “Everyone involved with the Lonsdale League are very shocked and saddened to hear of the untimely passing of Navan Harps FC player Oisin Fields. |
3 Jan 22 | Marcos Menaldo | 25 | ![]() |
Deportivo Marquense | Guatemalan Deportivo Marquense star centre back defender collapsed with a cardiac arrest in training at the Marquesa de la Ensenada Stadium in San Marcos on Monday shortly after complaining of breathing difficulties. He received CPR and was transferred to the Hospital de Especialidades where he died. News Story2 |
The cardiovascular deaths will continue to rise exponentially if and only if spike protein production continues in the fully vaxxed. We do not know if the immune system will eventually defeat the vaccinations and successfully remove every spike protein factory from the body. It looks from case number data that singly vaccinated people may win that battle. Presently we have no evidence that doubly vaccinated will win it because their case numbers continue to get worse and worse when compared to the unvaxxed. And boosted people have less chance even than them. So on the assumption that the exponential rise that we witnessed in 2021 will continue throughout 2022. Here is the future of cardiac mortality.
The latest ourworldindata (John's Hopkins University) figures for worldwide fully vaccinated people is 51.6% (January22). So for simplicity, assuming nobody is foolhardy enough to take a further vaccination after reading this article, we shall assume a 50:50 unvaccinated to fully vaccinated ratio throughout 2022.
Most people are not professional footballers and even the footballers themselves only spend a small fraction of their lives playing on the pitch. So the projection for cardiac deaths in 2022, just uses the fully vaxxed footrester figures, remembering that the normal worldwide cardiac death rate is 8.9 million per annum or 2.225 million per quarter. This translates to 1.1125 million per quarter for the 50% who are unvaxxed and 2.225 per quarter for the 50% who are fully vaxxed in Q4 2021. We then extrapolate exponentially from there on the basis of the exponential rise in footballer deaths seen and catalogued in 2021 which double every quarter.
So during 2022 rather than seeing the normal 8.9 million cardiovascular deaths , we shall see 71.2 million, an increase of 62.3 million deaths. At that point the vaccines will have killed more people that HIV AIDS - merely from heart attacks. This excludes deaths from VAIDS and from vaccine mediated neurological degeneration. There are nearly 8 billion of us. So 62.3 million is less than 1% of mankind. But it will be the largest genocide ever committed upon us, if the spike protein production keeps going at the present rate in the fully vaxxed.
________________________________
Vaccines program your cells to produce the 1273 Amino Acid Wuhan Hu1 spike protein and simulate a systemic infection. This trains your immune system to recognise and kill spike proteins as systemic infection causing pathogens. The entire process takes around 14 days, the typical length of a viral infection. That is why the government recommends that vulnerable people remain isolated for 14 days post injection and that is why the government produces stats which only recognise injected people as being the singly or doubly vaccinated 14 days after the 1st or the 2nd jab.
So we know that the work of the vaccine is completed by day 14.
So they cannot possibly wane in effectiveness themselves after that.
They conduct a 14 day training course and then they are supposed to clear off. Therefore they do not and they cannot wane in efficiency in months 2/3/4/5/6 because they do not do anything in those months. Their work is finished in 14 days. But the work of your immune system in never finished. So it is your immune system which is waning in months 2/3/4/5/6 not the vaccines. Your immune system is being redirected to fight spike proteins and therefore has less and less resources available to fight Covid. So a loss in apparent vaccine effectiveness is in fact a loss in immune system effectiveness.
There is a 1% drop in immune system capability per 1% drop in vaccine effectiveness (as measured by the case rate ratio between the vaxxed and the unvaxxed) if the vaccine had zero effectiveness upon injection (as is the case for 2 jabs and Omicron according to the University of Toronto study - https://www.medrxiv.org/content/10.1101/2021.12.30.21268565v1). In this case the possible range for vaccine effectiveness is 0 to -100% i.e. 100% total. So a 100% drop in vaccine effectiveness corresponds to a 100% drop in immune system capability. So each percentage drop in vaccine effectiveness corresponds to a one percent drop in Immune effectiveness.
There is a 0.5% drop in immune system capability per 1% drop in vaccine effectiveness (as measured by the case rate ratio between the vaxxed and the unvaxxed) if the vaccine had 100% effectiveness upon injection (Pfizer claimed 95% effectiveness against Wuhan allpha). In this case the possible range for vaccine effectiveness is +100% to -100% i.e. 200% total. So a 200% drop in vaccine effectiveness corresponds to a 100% drop in immune system capability. So each percentage drop in vaccine effectiveness corresponds to a half percent drop in Immune effectiveness.
All Covid vaccines drop in effectiveness persistently and inexorably until -99% (where case rates in the fully vaccinated are 100x greater than case rates in the unvaxxed - NSW in Australia has already reached 10x). Then they continue to approach 100% presumably, where case rates are hundreds and then thousands of times greater in the vaxxed than in the unvaxxed. Therefore all Covid vaccines progressively damage, degrade and destroy your immune system resulting in more infections, longer recovery times from infection and finally in sepsis (no recovery from infection without massive medical intervention).
Case Rate Ratio | Vaccine Efficiency | Fraction | Percentage | Percentage |
1/100 | (100-1)/100 | 0.99 | 99% | Vaccine |
1/20 | (20-1)/20 | 0.95 | 95% | Vaccine |
1/10 | (10-1)/10 | 0.9 | 90% | Vaccine |
1/5 | (5-1)/5 | 0.8 | 80% | Vaccine |
1/2 | (2-1)/2 | 0.5 | 50% | Vaccine |
1.25 | (1.25-1)/1.25 | 0.2 | 20% | Vaccine |
1 (10/10) | (1-1)/1 | 0 | 0% | No effect |
1.111 (10/9) | (1-1.111)/1.111 | -0.1 | -10% | Anti-Vaccine |
1.25 (10/8) | (1-1.25)/1.25 | -0.2 | -20% | Anti-Vaccine |
1.4285 (10/7) | (1-1.4285)/1.4285 | -0.3 | -30% | Anti-Vaccine |
1.666 (10/6) | (1-1.666)/1.666 | -0.4 | -40% | Anti-Vaccine |
2 (10/5) | (1-2)/2 | -0.5 | -50% | Anti-Vaccine |
2.5 (10/4) | (1-2.5)/2.5 | -0.5 | -60% | Anti-Vaccine |
3.333 (10/3) | (1-3.333)/3.333 | -0.7 | -70% | Anti-Vaccine |
5 (10/2) | (1-5)/5 | -0.8 | -80% | Anti-Vaccine |
10 (10/1) | (1-10)/10 | -0.9 | -90% | Anti-Vaccine |
20 | (1-20)/20 | -0.95 | -95% | Anti-Vaccine |
50 | (1-50)/50 | -0.98 | -98% | Anti-Vaccine |
100 | (1-100)/100 | -0.99 | -99% | Anti-Vaccine |
1000 | (1-1000)/1000 | -0.999 | -99.9% | Anti-Vaccine |
Once the Covid vaccines start to show a negative efficiency (which they are all now showing against Omicron), they become Antivaccines rather than vaccines. So the vaccinated have become the antivaccinated. And those who continue to promote vaccines knowing that they have now become antivaccines, are themselves antivaxxers.
Vaccines cannot wane in efficiency. They are binary. They show your immune system the spike protein antigen and they simulate a systemic attack to convince your immune system to take that spike protein seriously. Then there is NOTHING more for a true vaccine to do. They operate for 2-3 weeks, the normal length of a viral infection. Then they are supposed to leave your body. So they do not, they cannot, wane. They do not and cannot themselves drop in efficiency in the 2nd or 3rd or 4th or 5th month because they have nothing to do in those months. A worker who has finished his employment contract with a company cannot then work less efficiently for that company. He is no longer employed by that company.
But genetic vaccines continue to produce spike proteins incessantly. These damage your immune system incessantly. It is your immune system therefore that wanes. In the UK they have damaged our immune systems so much that vaccines now have enormous negative efficiencies up to -60% in the latest UKHSA data for the end of 2021 in certain age groups (Vaccine Surveillance Report Week 1). The trouble with the genetic vaccines that NOBODY talks about is that they do not stop producing spike proteins. They continue producing more and more of them. I asked Astra Zeneca for how long after vaccination would my cells produce spikes? They said we do not know we are still researching that. I do know because I did cell biology at Cambridge. Every vaccinated cell will continue producing spike proteins until it dies or is killed by your killer T cells.
So the results of the Worldovision Anti-Vaccine Contest are...
Les résultats du concours worldovision anti-vaccin sont donc...
Die Ergebnisse des Worldovision Anti-Vaccine Contest sind also...
Så resultaterne af Worldovision Anti-Vaccine Contest er...
Country | Fully Vaxxed to Unvaxxed Case rate ratio |
Anti-Vaccine Efficiency |
NSW Australia (Week1 of 2022: Nov26-Jan6 less Nov26-Jan1 - to be published in the Expose soon) | 10.72 | -90.7% |
Germany (RKI original Omicron figures up to December30) | 8.12 | -87% |
Scotland (Dec18 to Jan7) | 3.33 | -70% |
Denmark (Nov21 to Dec25) | 3.16 | -68% |
The USA (CDC data for Dec1-8) before they started rigging the Omicron data | 2.76 | -63.8% |
The UK (last 4 weeks of 2021) | 1.99 | -49.7% |
Canada (December14-January1) | 1.053 | -5% |
Tony Fauci, Bill Gates, Albert Bourla, Francis Collins, Rochelle Walensky, Joe Biden | Nul Points | Nul Points |
Let us be perfectly clear here. The table above is more a measure of the corruption of the respective government stats agencies than it is a measure of antivaccine efficiency and immune system degradation in the respective countries. The original German and Australian figures will be correct. The Canadian figures are very corrupt. The CDC and UK figures are corrupt. The Danish and Scottish figures are less corrupt.
CDC US figures for December1-8 were 8 cases in unvaccinated people and 34 cases in vaccinated people. On December4, 60.48% of Americans were fully vaxxed and 0.11% were singly vaxxed (ourworldindata) and therefore 39.41% were unvaxxed. So the case rate ratio was 34x39.41/8x60.59 = 2.76x and anti-vaccine efficiency was -63.8% - https://www.cdc.gov/mmwr/volumes/70/wr/mm7050e1.htm?s_cid=mm7050e1_w and https://www.westernjournal.com/cdc-announces-79-us-omicron-cases-occurred-vaccinated-individuals/
Here are the Danish figures from their Statens Serum Institut: Nov21 to Dec25 - https://files.ssi.dk/covid19/omikron/statusrapport/rapport-omikronvarianten-31122021-ct18
Vaccination status (12+ year olds) | Other variants (No. of cases) | Other variants (%) | Omicron (No. of cases) | Omicron (%) |
Not vaccinated | 21,390 | 23.7 | 3,500 | 8.5 |
Received first dose | 2,813 | 3.1 | 731 | 1.8 |
Completed primary vaccination schedule | 56,532 | 62.5 | 29,781 | 72.0 |
Revaccinated | 9,704 | 10.7 | 7,330 | 17.7 |
Total | 90,439 | 100.0 | 41,342 | 100.0 |
So the ratio of double or triple vaxxed Omicron cases to unvaxxed cases is 37,111 to 3500 or 10.6 to 1.
Whereas the vaccination rates at the mid point of the 34 day period on December8 were 76.83 fully vaxxed, 0.14% singly vaxxed and 23.03% unvaxxed.
So the case rate ration between fully vaxxed and unvaxxed was 10.6x23.03/76.83 = 3.18x.
So the anti-vaccine efficiency against Omicron in Denmark was (1-3.18)/3.18 = -68.6%
COVID-19 WEEKLY SURVEILLANCE IN NSW - https://www.health.nsw.gov.au/Infectious/covid-19/Documents/covid-19-surveillance-report-20220113.pdf
26November2021 to 1 January 2022
2021Nov25-2022Jan1: Vaccination Status | Total Cases | Case Rates per 100k |
Hospitalised (% of total cases) |
Hospitalised and in ICU (% of total cases) |
Death (% of total cases) |
Fully Vaccinated | 108,056 | 1420 | 1,280(1.2%) | 104(0.1%) | 22(<0.1%) |
Partially Vaccinated | 1,110 | 850 | 47(4.2%) | 8(0.7%) | 3(0.3%) |
No Effective Dose | 2,765 | 651.4 | 251(9.1%) | 42(1.5%) | 7(0.3%) |
Under Investigation | 28,181 | n/a | 395(1.4%) | 40(0.1%) | 2(<0.1%) |
Not eligible for vaccination (aged 0-11 years) | 12,328 | n/a | 93(0.8%) | 3(<0.1%) | 0(0.0%) |
Total | 152,440 | 1867 | 2,066(1.4%) | 197(0.1%) | 34(<0.1%) |
The mid point of the period from 2021November26 to 2022January1 was 2021 December13/14, when 93.2% were fully vaxxed in NSW, and 94.8% were first dosed. So 5.2% were unvaxxed - https://www.covid19data.com.au/vaccine-forecasts
So the ratio of the case rates fully vaxxed to unvaxxed is 5.2 x 108,056/2,765 x 93.2 = 2.18x
COVID-19 WEEKLY SURVEILLANCE IN NSW - https://www.health.nsw.gov.au/Infectious/covid-19/Documents/covid-19-surveillance-report-20220120.pdf
26November2021 to 8January 2022
2021Nov26-2022Jan8: Vaccination Status | Total cases | Case Rates per 100k |
Hospitalised (% of total cases) |
Hospitalised and in ICU (% of total cases) |
Death (% of total cases) |
Two Effective Doses | 267,381 | 3509 | 2,627(1.0%) | 215(0.1%) | 67(<0.1%) |
One Effective Dose | 2,578 | 2091 | 80(3.1%) | 12(0.5%) | 3(0.1%) |
No Effective Dose | 3,552 | 844.9 | 315(8.9%) | 55(1.5%) | 21(0.6%) |
Under Investigation | 74,878 | n/a | 881(1.2%) | 106(0.1%) | 6(<0.1%) |
Not Eligible for Vaccination (aged 0-11 years) | 30,667 | n/a | 197(0.6%) | 7(<0.1%) | 1(<0.1%) |
Total | 379,056 | 4644 | 4,100(1.1%) | 395(0.1%) | 98(<0.1%) |
The mid point of the period from 2021November26 to 2022January8 was 2021December17, when 93.34% were fully vaxxed in NSW, and 94.85% were first dosed. So 5.15% were unvaxxed - https://www.covid19data.com.au/vaccine-forecasts
So the ratio of the case rates fully vaxxed (2 or more effective doses) to unvaxxed is 5.15 x 267,381/3,552 x 93.34 = 4.15x
We can subtract the two tables above and get the new cases in Week1 from 2-8 January 2022. These were...
2022Jan2-8: Vaccination Status | Total Cases | Case Rates per 100k NSW pop = 8.163m |
Two Effective Doses | 159,325 | 2085 |
One Effective Dose | 1,468 | 1266 |
No Effective Dose | 787 | 194.4 |
Under Investigation | 46,697 | n/a |
Not Eligible for Vaccination (aged 0-11 years) | 18,339 | n/a |
Total | 226,616 | 2776 |
The mid point of the period from 2022January2 to 2022January8 was 2022January5, when 93.62% were fully vaxxed in NSW, and 95.04% were first dosed. So 4.96% were unvaxxed - https://www.covid19data.com.au/vaccine-forecasts
So the ratio of the case rates in the first week in January in New South Wales Australia was 4.96 x 159,325/787 x 93.62 = 10.72x.
This gives a vaccine efficiency of (1-10.72)/10.72 = -90.7%
Or putting it another way 787 cases of Omicron cases in NSW in the first week of this year were in unvaxxed and 160,793 were in the singly or doubly or triply vaccinated.
This means that less than half a percent of the cases were in the unvaxxed and more than 99.5% of the cases were in the vaxxed. Now that is a pandemic of the vaccinated for you. Effective dose? Right. Well effective.
These massive increases in vaxxed case rates compared to unvaxxed case rates from 2.18x for Nov26-Jan1 to 4.15x for Nov26-Jan8 to 10.72x for Jan2-8 are largely due to Omicron being able completely to evade the vaccines and therefore lay bare the immune destruction they cause, which is covered up for in Delta case numbers due to a degree of vaccine efficiency against Delta..
Your immune system kills every vaccinated cell in your body
Vaccination informs your immune system that spike proteins are very dangerous antigens (by simulating a systemic infection coincident with the presentation of the spike protein antigen). So it kills the spike proteins and kills every cell in your body that has been vaccinated because all of those cells are genetically reprogrammed by the vaccine to make spike proteins and your immune system identifies and recognises vaccinated cells as spike protein factories..
So your body goes into a perpetual civil war in which more and more of your immune resources are spent killing vaccinated cells. Pfizer contains 14.4 trillion 1273 Amino Acid spike protein mRNA copies and Moderna contains 48 trillion - see here. You only have between 6 and 36 trillion cells in your body (depending upon how you count them). Some of these cells such as heart muscle cells and brain cells do not get replaced. If they become vaccinated, you will lose them indefinitely. Myocarditis is caused by Killer T cells removing vaccinated heart cells.
This gets worse at the 2nd jab and worse still at the 3rd.
You may think that vaccines are safe but your immune system would beg to differ
Your trusty immune system kills every single vaccinated cell it can find. In deed it is the vaccine which trains it to kill them. It is this civil war which causes the vaccine efficiency to look like it is decreasing. But it is not decreasing at all. Your immune system response is decreasing. You are developing VAIDS, Vaccine Acquired Immune Deficiency Syndrome.
The law of inverse political results
Having studied the efficiency of politicians at fulfilling their election promises for 50 years, a family member of mine formulated with law of inverse political results. This law states that politicians always achieve in office the precise opposite of what they promise at elections. His theory is that if one wants a true capitalist government, one should vote for Jeremy Corbyn. And if one wants a true communist dictatorship, one should vote for Boris Johnson. To be fair to both politicians, the law does not suggest that said result reversal is entirely the fault of the respective politician. A lot of the reversal of their promises comes about due to the reactionary, indignant, incompetent and contrarian nature of the blob of the civil service. But it is a good 'Yes Minister' type rule of thumb. So when a government recommends and even mandates a medical intervention, the result according to this law will be the precise opposite of what the politicians promise. And indeed that has turned out to be the case. The politicians promised that vaccinations would end the pandemic. But vaccinations have not ended the pandemic. They have prolonged the pandemic, by degrading the immune systems of the vaccinated, who are now condemned to be reinfected by previously trivial viruses, indefinitely. They promised us vaccines. They gave us antivaccines. That is the law of inverse political results.
------------------------------------
1. mRNA vaccines are not gene therapy
2. mRNA vaccines are just a more high tech version of your regular flu shot vaccine.
3. mRNA vaccines are destroyed by your immune system within a couple of days
4. mRNA vaccines do not leave the injection site in your deltoid shoulder muscle
5. mRNA vaccines are safe
6. mRNA vaccines are effective
7. mRNA vaccines wane in efficiency over time
8. Masks protect us all from Covid
9. Mass vaccination should occur during a pandemic
10. Lockdowns are beneficial
11. Vaccine Immunity is as good or better than natural immunity
12. Therapeutics such as Vitamin D, Ivermectin. Budesonide, Intravenous Vitamin C, Mouthwashes with Cetylpyridinium Chloride, Zinc and Quercetin. N-Acetylcysteine (NAC), Hydroxychloroquine are ineffective and/or dangerous and should be denied.
13. Vaccines do not cause miscarriages.
14. Vaccine mediated Myocarditis is mild.
15. Hands and surfaces can spread Covid. So we should deploy hand sanitizers
16. Asymptomatic people can spread Covid
17. Vaccines are effective against Omicron
18. The Spike protein is the best viral component to use in a vaccine
19. Vaccination is a one size fits all solution for every single human being on the planet
1. mRNA vaccine are gene therapy, because they reprogram vaccinated cells at a genetic level to produce Covid spike proteins.
2. mRNA vaccines do present the 1273 Amino Acid Wuhan Hu1 spike protein to you immune system. But then they damage your immune system to the point where you are more likely to be infected with Covid than an unvaxxed person. So in truth they are anti vaccines. A true vaccination provides long term immunity, just as infection recovery provides long term natural immunity. mRNA vaccines only provide short term immunity for a few months. then they go negative in efficiency and become anti vaccines. So actually the fully vaccinated are the true anti-vaxxers, having been fully antivaccinated,
3. RNA which is not protected by lipid nanoparticles is indeed destroyed in a few days. mRNA vaccines which have lipid nanoparticle case, are not. This is obvious from the known fact that leaving a 12 week gap between the 1st and 2nd jabs, produces a 3.5x stronger antibody response than leaving a 4 week gap (https://todaynewspost.com/news/world/uk-news/longer-gap-between-pfizer-jabs-boosts-antibody-response-in-elderly/ ). So in those extra 8 weeks of gap, something cumulative is going on. That something can only be spike protein production. Indeed the DNA vaccine from Astrazeneca produces a 4x greater antibody response with a 12 week gap between the first two injections and an 18x greater antibody response with a 45 week gap (https://www.foxnews.com/health/astrazenecas-covid-19-vaccine-stronger-immunity-45-week-gap-company). So the 12 week behaviour of mRNA vaccines is hardly any different from that of the DNA vaccines. But DNA vaccines make a permanent change in your cell DNA (adding the spike protein DNA to the cell nuclei of vaccinated cells). Therefore the mRNA is just as permanent as the DNA (certainly up to 12 weeks). The mRNA does not degrade in the first 2 days as it should. The lipid nanoparticle coating makes it almost as permanent as DNA vaccines. The other possibility which has been shown to be possible by swedish () is the the mRNA writes itself into your cell nuclei by a process called reverse transcription. DNA is supposed to write itself to RNA, which goes off to program your cell ribosomes to make proteins. That is transcription. Reverse transcription occurs when RNA writes itself into your nucleic DNA
4. When you are vaccinated, the pressure exerted through the tiny needle forces the vaccine containing 14.4 trillion (Pfizer) or 48 trillion (Moderna) copies of the Wuhan Hu1 Spike protein RNA in a nano lipid particle coating into your deltoid muscle cells and into the interstitial space between those cells. If you are unlucky, because nobody bothers to aspirate the vaccination, which used to be standard practice, when the health of the patient was a concern, the needle hits a vein and you get trillions of spike proteins charging straight into your heart. If you are lucky, then the interstitial fluid between your muscle cells drains into your lymphatic system and from there into your blood stream and from there into your heart in smaller quantity and at a much slower rate. But make no mistake. Your immune system recognises every vaccinated cell that starts to produce spike proteins and sends killer T cells to destroy it. If that cell is in your shoulder muscle fine. If that cell is in your heart muscle or your brain - not fine. Professor Neils Hoibe from the University of Copenhagen (781 publications, 44,327 citations) describes this process in a video with Dr John Campbell (both are careful not to be seen as too antivax) - https://www.youtube.com/watch?v=hkopHLQjtVQ
5. The UK Medicine Regulator has confirmed that over a period of twelve months the Covid-19 Vaccines have caused 5x times more deaths than the total number of deaths due to all other available vaccines combined in the past 21 years - https://dailyexpose.uk/2022/01/21/mhra-covid-vaccine-deaths-unprecedented/
6. The latest Australian data for the 1st week in 2022 from 2022January2-8, shows that fully vaccinated Aussies are now 10.72x more likely to become infected with Omicron as unvaxxed Australians
Here are the case numbers for Week1 in NSW...
Vaccination Status | Total Cases |
Two Effective Doses | 159,325 |
One Effective Dose | 1,468 |
No Effective Dose | 787 |
Under Investigation | 46,697 |
Not Eligible for Vaccination (aged 0-11 years) | 18,339 |
Total | 379,056 |
The mid point of the period from 2022January2 to 2022January8 was 2022January5, when 93.62% were fully vaxxed in NSW, and 95.04% were first dosed. So 4.96% were unvaxxed - https://www.covid19data.com.au/vaccine-forecasts
So the ratio of the case rates in the first week in January in New South Wales Australia was (4.96 x 159,325)/(787 x 93.62) = 10.72x
Or putting it another way 787 cases of Omicron cases in NSW in the first week of this year were in unvaxxed and 160,793 were in the singly or doubly or triply vaccinated.
This means that less than half a percent of the cases were in the unvaxxed
and more than 99.5% of the cases were in the vaxxed. Now that is a pandemic of the vaccinated for you. Effective dose? Right. Well effective.
7. Vaccines are not Waning. Vaxxed immune systems are waning
Vaccines cannot wane in efficiency. They are digital. They show your immune system the spike protein antigen and they simulate a systemic attack to convince your immune system to take that spike protein seriously. Then there is NOTHING more for a true vaccine to do. They operate for 2-3 weeks, the normal length of a viral infection. Then they are supposed to leave your body. So they do not, they cannot, wane. They do not and cannot drop in efficiency in the 2nd or 3rd or 4th or 5th month because they have nothing to do in those months. A worker who has finished his employment contract with a company does not work less efficiently for that company. He is no longer employed. .
But genetic vaccines continue to produce spike proteins incessantly. They damage your immune system.
It is your immune system therefore that wanes. In the UK they have damaged our immune systems so much that vaccines now have enormous negative efficiencies up to -60% in the latest UKHSA data for the end of 2021 (Vaccine Surveillance Report Week 1). The trouble with the genetic vaccines that NOBODY talks about is that they do not stop producing spike proteins. They continue producing more and more of them. I asked Astra Zeneca for how long after vaccination would my cells produce spikes? They said we do not know we are still researching that. I do know because I did cell biology at Cambridge. Every vaccinated cell will continue producing spike proteins until it dies or is killed by your killer T cells.
Vaccination informs your immune system that spike proteins are very dangerous antigens (by simulating a systemic infection coincident with the presentation of the spike protein antigen). So it kills the spike proteins and kills every cell in your body that has been vaccinated because all of those cells are genetically reprogrammed by the vaccine to make spike proteins.
So your body goes into a perpetual civil war in which more and more of your immune resources are spent killing vaccinated cells. Pfizer contains 14.4 trillion 1273 Amino Acid spike protein mRNA copies and Moderna contains 48 trillion - see here. You only have between 6 and 36 trillion cells in your body (depending upon how you count them). Some of these cells such as heart muscle cells and brain cells do not get replaced. If they become vaccinated, you will lose them indefinitely. Myocarditis is caused by Killer T cells removing vaccinated heart cells.
This gets worse at the 2nd jab and worse still at the 3rd. You may think that vaccines are safe but your immune system would beg to differ since it kills every vaccinated cell it can find. In deed it is the vaccine which trains it to do that. It is this civil war which causes the vaccine efficiency to look like it is decreasing. It is not, your immune system response is decreasing. You are developing VAIDS, Vaccine Acquired Immune Deficiency Syndrome.
8. The Brownstone Institute has over 150 studies showing that masks do not help - https://brownstone.org/articles/more-than-150-comparative-studies-and-articles-on-mask-ineffectiveness-and-harms/
9. Dr. Roger Hodkinson, the former Chairman of the Royal College of Physicians and Surgeons in Canada (based in Ottawa), and for the past 20 years Chairman of a Medical Biotechnology company based in North Carolina explains in this video why you should not vaccinated in the middle of a Pandemic (when there is a huge amount of the virus around to work on overcoming the vaccine). He is a medical specialist in pathology, which includes virology, who studied medicine at Cambridge University in the UK. He reminds the medical establishment that the primary rule of vaccination is that you never do it duuring a pandemic.
10. Targeted lockdowns of the sick and the vulnerable would have been better but still not optimal. General lockdowns kill 2 people tomorrow for every one person they save today. This is all covered in great detail by the Great Barrington Declaration, which now has 920,000 signatures (2022January25). But the answer is now and has always been to quarantine the sick, not the healthy (however vulnerable). Every family should have been given a temperature gun (cost would be $8 x 20 million = $160 million). And anyone with a temperature should have been isolated until they no longer have a temperature. Furthermore, all large shops and venues and tube stations etc. should have had them on the doors and should have them today if we actually wanted to stop the spread rather than isolate people one from another.
11. Vaccines simulate the infection they are supposed to protect you from. They cannot therefore be better than the natural immunity which they simulate. Is any Elvis impersonator better than the king? The CDC now admits that natural immunity is better than vaccine immunity (having denied it for as long as they could) - https://fee.org/articles/cdc-natural-immunity-offered-stronger-protection-against-covid-than-vaccines-during-delta-wave/
In a natural infection the immune system indeed chops up the entire virus into segments and makes different antibodies for each segment. Natural immunity therefore results in 8x more types of antibody than vaccination which only presents 1/8th of the viral proteins to your immune system. Furthermore the immune system does not have Alzheimer's. It does not forget what it has learned from a real infection. If it did we would all be dropping dead of measles. Vaccine Passport schemes are a denial of Natural Immunity. They are no different from Ayatollah Knomeini's abolition of Newton's laws during the Iranian Revolution and no less futile. Vaccinated people have damaged immune systems and therefore have higher viral loads for Omicron than unvaxxed people and higher infection rates and are more likely to spread Covid than the unvaxxed, many of whom have natural immunity which has not been compromised by VAIDS.
12. A thorough analysis of the efficacy of early treatment with non vaccine therapeutics from 722 clinical studies is given here - https://rightsfreedoms.wordpress.com/2021/05/29/covid-19-early-treatment-real-time-analysis-of-659-studies/
13. VAERS - https://vaers.hhs.gov/data/datasets.html
There were 48 Sepsis cases reported to VAERS in 2020 = 4 per month
There were 1364 sepsis cases for 2021, making an average = 114 per month
There were 63 Sepsis cases from 2022 Jan1-14.= 139 per month.
There were 23 miscarriages reported to VAERS in 2020 = 2 per month.
There were 1299 miscarriages in 2021 = 108 per month
There were 46 miscarriages from 2022Jan1-14 = 110 per month
14. Myocarditis has a 56% mortality rate within 4.3 years according to the American Heart Association - https://www.vaccinedeaths.com/2021-11-08-vaccine-induced-myocarditis-children-50percent-fatality-rate.html
Dr. Anthony Hinton, a consultant surgeon with 30 years of experience working for the United Kingdom’s National Health Service (NHS), has warned that Wuhan coronavirus (Covid-19) “vaccine”-related myocarditis has a 20 percent fatality rate in children after two years, and a 50 percent fatality rate in five years.
In a tweet, Hinton explained that viral myocarditis is “not mild,” adding that “[i]t’s dead heart muscle.” To even suggest that myocarditis is in any way mild is akin to saying that a person is “a little bit pregnant,” added Scottish television presenter and author Neil Oliver.
The American Heart Association medical journal Circulation explains that myocarditis results in a 56% mortality rate in 4.3 years. Giant cell myocarditis had an 80% mortality rate in five years.
The Myocarditis Treatment Trial reported mortality rates for biopsy-verified myocarditis of 20% and 56% at 1 year and 4.3 years, respectively. These outcomes are similar to the Mayo Clinic’s observational data of 5-year survival rates that approximate 50%. Survival with giant cell myocarditis is substantially lower, with <20% of patients surviving 5 years - https://www.ahajournals.org/doi/full/10.1161/circulationaha.105.584532
15. Covid is a respiratory disease it is spread by micro-droplets of water in the air not by hand shakes or surfaces. Dr Peter McCulloch - Covid-19 A Second Opinion hosted by Senator Ron Johnson - A MUST SEE DISCUSSION.
16. Coughs and sneezes spread diseases. Asymptomatic people are not fighting a war with covid, or have won the war with covid. They do not spread it. You spread it when you are fighting it and have not yet won the battle. Covid is spread from "symptomatic people to susceptible people" Dr Peter McCulloch - Covid-19 A Second Opinion hosted by Senator Ron Johnson - A MUST SEE DISCUSSION.
17. The genetic vaccines are 3 years out of date
This years flu shot is a combination of last year's flu virus and as many as possible of the viruses from the years before that. They are inactivated and shown to your immune system by the vaccination. The reason flu shots are not very effective is that
influenza is programmed to produce variants faster than mankind can produce and get approval for new flu shots. So every flu shot is out of date before it is administered. The situation is worse with Covid-19 shots. We are now is 2022.
What use is a shot against a spike protein from a virus identified in 2019? It is 3 years out of date. That is why it has almost zero effectiveness against Omicron at first and absolutely zero effectiveness after a few weeks and progressively increasing negative effectiveness after that.
The idea that you should lose your job because you fail to take an immuno destructive, 3 year out of date vaccine for a variant of Covid that no longer exists is beyond absurd.
If the Pfizer cared about your health they would have updated the RNA in the vaccines to Beta, to Delta and now to Omicron. They do that every year with the flu shot. Why has it not occurred with the vaccines, which are now 3 years out of date?
A Toronto University study showed the doubly vaccinated people had absolutely no measurable protection against Omicron - receipt of 2 doses of COVID-19 vaccines was not protective against Omicron. Vaccine effectiveness against Omicron was 37% (95%CI, 19-50%) ≥7 days after receiving an mRNA vaccine for the third dose. - https://www.medrxiv.org/content/10.1101/2021.12.30.21268565v1
The booster protection will be due to the immune system being put into a hyper alert state and therefore will be transient lasting around 2 months maximum (as case ratio data now shows).
18. The wrong vaccine and the right vaccine
The Covid spike protein has 1/8th of the proteins in the entire virus. The Immune system cuts up viruses and makes antibodies for each resulting protein segment. The most pathogenic part of the Covid-19 virus is the spike protein. It is therefore absolutely the wrong part of the virus to use in a vaccination. Dr Richard Flemming has revealed that researchers have already shown that the nucleocapsid part of the virus (the case for the nucleus) produces a more effective vaccination which is not pathogenic. The correct vaccine would actually use segments of all the known variants of Covid and deliberately exclude their spike proteins which are known pathogens. The type of vaccination should be standard (like Sputnik) not genetic.
So in summary the Pfizer and Moderna shots use the wrong part of the wrong variant in the wrong type of vaccination method. They should be using the non spike parts of all the variants in a non genetic vaccine. That would be safe and that would be effective BECAUSE all a vaccination is, is a way of convincing the body that it has had the infection. Then you get, through the vaccine, a poor copy of what you would have got through natural infection. A vaccination can never be as effective as the thing it is trying to simulate or mimic. I mean is an Elvis impersonator ever as good as the king?
"Not only do these vaccines not work if you look at the Emergency Use Authorisations. But the data clearly shows that they are suppressing our immune system. They are suppressing our production of interferon. They are depressing our production of key helper T cells. When people are given Moderna and Pfizer vaccines and then given an influenza vaccine they are not mounting an influenza immune response. It is blunted.
We know that the T cells, the critical cells in the inate system go down after the first Pfizer vaccine shot. We know that natural immunity, person to person immunity, is long lasting provides memory cells up front, it provides not only IgM (Immunoglobulin Mu antibodies) and IgG (Immunoglobulin Gamma antibodies) but it provides the critical IgA antibody for our lungs and our Gastro Intestinal tract. We know that if you've been exposed to inlfuenza or cytomegalovirus you probably already have some natural immunity. And what we now know most recently is that I have told people these vaccines only picked out the spike protein of the SARS CoV Wuhan HU1 variant and so the further away we have gotten from that the more we have put a pressure selection on the delta variant and the mu and the lambda variants but here is the thing...
What we now know is that the greatest natural immunity to this virus comes off the nucleocapsid component of it (not the spike protein) which you can only get if you get it from person to person (transmission), that data just recently came out. So they are not even vaccinating for the right bloody part of the virus to begin with and like I've said before we have always done vaccines where we have taken all the variants with all the parts and injected that into you so your body and make an immune response to all the variants and all the parts. So that it bloody well works. This is the most - this is Jurassic park literally. They were given the tools by people that they stood on the shoulders of. Some of it was work that I did that they literally stole out of the work I was doing in the early 1990s on inflammation where they used that Shi Zeng lee used that to help formulate how she was gonna put that glycoprotein 120 there" - Dr Richard Flemming in Brighteon Conversations.
19. There has never in the history of medicine been a drug which is suitable for every single person on the planet because we are all so gloriously different. Indeed several types of people were excluded from the Pfizer vaccines trials because Pfizer knew that the drug would be dangerous or inefficacious for them. These groups were - https://www.nejm.org/doi/suppl/10.1056/NEJMoa2110345/suppl_file/nejmoa2110345_protocol.pdf
1. Other medical or psychiatric condition including recent (within the past year) or active suicidal ideation/behavior or laboratory abnormality that may increase the risk of study participation or, in the investigator’s judgment, make the participant inappropriate for the study.
2. Known infection with human immunodeficiency virus (HIV), hepatitis C virus (HCV), or hepatitis B virus (HBV).
3. History of severe adverse reaction associated with a vaccine and/or severe allergic reaction (eg, anaphylaxis) to any component of the study intervention(s).
4. Receipt of medications intended to prevent COVID-19.
5.Stages 1 and 2 only: Previous clinical or microbiological diagnosis of COVID-19.
6.Sentinel participants in Stage 1 only:
Individuals at high risk for severe COVID-19, including those with any of the following risk factors:
• Hypertension
• Diabetes mellitus
• Chronic pulmonary disease
• Asthma
• Current vaping or smoking
• History of chronic smoking within the prior year
• BMI >30 kg/m2
• Anticipating the need for immunosuppressive treatment within the next 6 months
7.Sentinel participants in Stage 1 only: Individuals currently working in occupations with high risk of exposure to SARS-CoV-2 (eg, healthcare worker, emergency response personnel).
8. Immunocompromised individuals with known or suspected immunodeficiency, as determined by history and/or laboratory/physical examination.
9. Individuals with a history of autoimmune disease or an active autoimmune disease requiring therapeutic intervention, including but not limited to: systemic or cutaneous lupus erythematosus, autoimmune arthritis/rheumatoid arthritis, Guillain-Barré syndrome, multiple sclerosis, Sjögren’s syndrome, idiopathic thrombocytopenia purpura, glomerulonephritis, autoimmune thyroiditis, giant cell arteritis (temporal arteritis), psoriasis, and insulin-dependent diabetes mellitus (type 1).
10. Bleeding diathesis or condition associated with prolonged bleeding that would, in the opinion of the investigator, contraindicate intramuscular injection.
11. Women who are pregnant or breastfeeding.
Prior/Concomitant Therapy:
12. Previous vaccination with any coronavirus vaccine.
13. Individuals who receive treatment with immunosuppressive therapy, including cytotoxic agents or systemic corticosteroids, eg, for cancer or an autoimmune disease, or planned receipt throughout the study. If systemic corticosteroids have been administered short term (<14 days) for treatment of an acute illness, participantsshould not be enrolled into the study until corticosteroid therapy has been discontinued for at least 28 days before study intervention administration. Inhaled/nebulized, intra-articular, intrabursal, or topical (skin or eyes) corticosteroids are permitted.
14. Receipt of blood/plasma products or immunoglobulin, from 60 days before study intervention administration or planned receipt throughout the study
Given that pregnant women, breastfeeding women, diabetics, HIV patients etc. were excluded for reasons of safety and efficacy. Why are the vaccines being mandated for those people?
----------------------------
This is not a billion dollar fraud. It does not merely deprive you of your livelihood. It deprives you of your health. It deprives you of your faculties, your ability to run, your ability to remember, your ability to think clearly, your ability to work profitably, your ability to have children and your chance to reach your full potential. But worse than that it deprives those whom you love of their health, of their faculties and in the end of their lives. This is a fraud that makes Bernie Madoff look like a saint, a rookie, an amateur. And it will end in a genocide of such magnitude as would make Pol Pot look like Florence Nightingale. Indeed the Pol Pots of this genocide dress themselves up as Florence Nightingales each night on our TV screens and in our internet newscasts, as legions of medically unqualified media prostitutes sing the song they are paid to sing to their viewers and their listeners, with the catchy refrain that goes:
Vaccines are Safe and Vaccines are Effective
You can trust the press and the people you elected.
They are of course especially safe and effective for those whom Pfizer excluded from their Phase III vaccine trials precisely because the vaccine was known or suspected to be neither safe nor effective for them. The excluded groups were - https://www.nejm.org/doi/suppl/10.1056/NEJMoa2110345/suppl_file/nejmoa2110345_protocol.pdf
1. Other medical or psychiatric condition including recent (within the past year) or active suicidal ideation/behavior or laboratory abnormality that may increase the risk of study participation or, in the investigator’s judgment, make the participant inappropriate for the study.
2. Known infection with human immunodeficiency virus (HIV), hepatitis C virus (HCV), or hepatitis B virus (HBV).
3. History of severe adverse reaction associated with a vaccine and/or severe allergic reaction (eg, anaphylaxis) to any component of the study intervention(s).
4. Receipt of medications intended to prevent COVID-19.
5.Stages 1 and 2 only: Previous clinical or microbiological diagnosis of COVID-19.
6.Sentinel participants in Stage 1 only:
Individuals at high risk for severe COVID-19, including those with any of the following risk factors:
• Hypertension
• Diabetes mellitus
• Chronic pulmonary disease
• Asthma
• Current vaping or smoking
• History of chronic smoking within the prior year
• BMI >30 kg/m2
• Anticipating the need for immunosuppressive treatment within the next 6 months
7.Sentinel participants in Stage 1 only: Individuals currently working in occupations with high risk of exposure to SARS-CoV-2 (eg, healthcare worker, emergency response personnel).
8. Immunocompromised individuals with known or suspected immunodeficiency, as determined by history and/or laboratory/physical examination.
9. Individuals with a history of autoimmune disease or an active autoimmune disease requiring therapeutic intervention, including but not limited to: systemic or cutaneous lupus erythematosus, autoimmune arthritis/rheumatoid arthritis, Guillain-Barré syndrome, multiple sclerosis, Sjögren’s syndrome, idiopathic thrombocytopenia purpura, glomerulonephritis, autoimmune thyroiditis, giant cell arteritis (temporal arteritis), psoriasis, and insulin-dependent diabetes mellitus (type 1).
10. Bleeding diathesis or condition associated with prolonged bleeding that would, in the opinion of the investigator, contraindicate intramuscular injection.
11. Women who are pregnant or breastfeeding.
Prior/Concomitant Therapy:
12. Previous vaccination with any coronavirus vaccine.
13. Individuals who receive treatment with immunosuppressive therapy, including cytotoxic agents or systemic corticosteroids, eg, for cancer or an autoimmune disease, or planned receipt throughout the study. If systemic corticosteroids have been administered short term (<14 days) for treatment of an acute illness, participantsshould not be enrolled into the study until corticosteroid therapy has been discontinued for at least 28 days before study intervention administration. Inhaled/nebulized, intra-articular, intrabursal, or topical (skin or eyes) corticosteroids are permitted.
14. Receipt of blood/plasma products or immunoglobulin, from 60 days before study intervention administration or planned receipt throughout the study
But hey, lets mandate that ALL public sector staff in the US and ALL care home staff in the UK and ALL citizens of Austria and Australia and Canada must be vaccinated. To hell with pregnant women, breastfeeding women, HIV patients. Diabetics, the immunocompromised, the obese, the smokers, the Hepatitis sufferers, the Arthritics, the Multiple Sclerotics, the Allergy sufferers, the Asthmatics etc., upon whom no trial took place.
Incidentally my apologies for not adding the above to the list of 18 Covid19 Deceptions. Obviously it should have been a list of 19 Covid19 deceptions. Let's regard this article as an exposition of the 19th Covid19 deception!
For it is a conspiracy so malignant and so inhuman that no Bond Villain would dare attempt it and no screenwriter would dare pen it. It's scope is so universal, so international, so global is its reach, that no government has dared oppose it (for long). It has behind it men and women so rich and so powerful that they can literally 'exclude' those who see through it from modern society.
So let us consider the forefather of the present attempt at global dictatorship through every means possible, One Adolf Hitler. There is a wonderful quote which is variously attributed to Hitler and to Joseph Goebbels -
“If you tell a lie big enough and keep repeating it, people will eventually come to believe it. The lie can be maintained only for such time as the State can shield the people from the political, economic and/or military consequences of the lie. It thus becomes vitally important for the State to use all of its powers to repress dissent, for the truth is the mortal enemy of the lie, and thus by extension, the truth is the greatest enemy of the State.”
We are presently in that precise situation with: Vaccines are Safe and Efficient. Governments and large corporations worldwide have been repressing dissent from that lie in an unprecedented manner. This repression should be an unmistakable flag to all mankind that the statement is a lie. But regrettably, it has not been so far.
I would add one further tool to the art of selling the big lie, and that is status. People do not believe fact. They do not believe scientific truth. They do not believe logic. If people believed either logic or science nobody would have taken the vaccine, because flu vaccines have never worked very well in humans (being at least one year out of date when they are administered) and genetic vaccines have always proven lethal in animal trials and the spike protein is the wrong protein to use in a vaccination, and because any genetically vaccinated cell has to be killed by the immune system, so your immune system is telling you that vaccines are lethal to your cells. And because the golden rule of immunology is NEVER vaccinate during a pandemic, because it will create variants. this occurs because during a pandemic there is a maximum amount of pathogen about to mutate around the vaccine..
What people believe is status. They believe celebrity. They believe in the rich, They believe in the famous. They believe in the powerful. They believe in the successful. They say that nothing succeeds like success. This is because success creates credibility which leads to faith and to trust.
So here are the 5 pillars of deception
1. Lie so greatly that nobody believes such a lie could be possibly be realistically championed
2. Repeat the lie indefinitely
3. Use the state to shield its citizens not from the lie, but from the consequences of the lie
4. Repress the truth and those who promote it mercilessly
5. Ensure that ALL high status sources promote, espouse, live, breathe and crap the lie.
And here is how those 5 pillars are being carried out right now as you read this piece.
1. The lie is that the Covid Vaccines are Safe and Effective, The truth is that they are not vaccines, they are not safe and they are not effective against Covid. A vaccine cannot have negative efficacy. The latest figures in most countries now show that the vaccines have negative efficacy against Omicron. That means they are not vaccines. They are gene therapy sold as a vaccine. So the question that remains is: What are they doing to our genes? The answer exposes the biggest deception of all time and is so incredible that if I tell you it now, you will most likely stop reading. So I will address it later in the article. But so as not to leave you in the dark. It has to do with the fundamental question: Who owns your body?
2. As we know from A State of Fear by Laura Dodsworth, the government has an entire department SPI-B dedicated to Psyops reinforcing the message that Vaccines are Safe and Effective.
3. The shield that governments of the world are using to hide the consequences of the lie from their people is corrupt false and manipulated statistics.
Here are two of my favourite examples of this. They are both so stupid as to be laughable. Except that there is nothing at all funny about the pain misery and death that believing them is causing to mankind.
Here are the ONS data on deaths and person years by vax status for 2021Jan1 to 2021Oct31 - from https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/deaths/datasets/deathsbyvaccinationstatusengland
All mortality per 100,000 person years = 100,000 x All Deaths/Person years
Non Covid mortality per 100,000 person years = 100,000 x Non Covid19 deaths/Person years
Covid mortality per 100,000 person years = 100,000 x Covid19 deaths/Person years
Vaccine Efficacy against All mortality = (unvaxxed mortality rate per 100,000 person year -double vaxxed mortality rate per 100,000 person years)/larger of the two
Vaccine Efficacy against Non Covid mortality = (unvaxxed mortality rate per 100,000 person year -double vaxxed mortality rate per 100,000 person years)/larger of the two
Vaccine Efficacy against Covid mortality = (unvaxxed mortality rate per 100,000 person year -double vaxxed mortality rate per 100,000 person years)/larger of the two
Vax Status Double vaxxed are 21+ days |
Age | Person years | Covid Deaths |
Non Covid Deaths |
All Deaths | All Mortality per 100,000 Person years |
Non Covid Mortality per 100,000 Person years |
Covid Mortality per 100,000 Person years |
Vaccine Efficacy against All mortality |
Vaccine Efficacy against non Covid mortality | Vaccine Efficacy against Covid mortality |
Unvaccinated | 10-14 | 2,094,711 | 2 | 94 | 96 | 4.6 | 4.5 | 0.1 | -98.1% | -98.1% | 100.0% |
double vaxxed | 10-14 | 1,678 | 0 | 4 | 4 | 238.4 | 238.4 | 0.0 | |||
Unvaccinated | 15-19 | 1,587,072 | 18 | 142 | 160 | 10.1 | 8.9 | 1.1 | -69.3% | -72.1% | 31.0% |
double vaxxed | 15-19 | 127,842 | 1 | 41 | 42 | 32.9 | 32.1 | 0.8 | |||
Unvaccinated | 20-24 | 1,253,977 | 31 | 189 | 220 | 17.5 | 15.1 | 2.5 | -11.1% | -21.4% | 77.5% |
double vaxxed | 20-24 | 359,959 | 2 | 69 | 71 | 19.7 | 19.2 | 0.6 | |||
Unvaccinated | 25-29 | 1,246,537 | 55 | 282 | 337 | 27.0 | 22.6 | 4.4 | -0.5% | -10.5% | 57.5% |
double vaxxed | 25-29 | 427,061 | 8 | 108 | 116 | 27.2 | 25.3 | 1.9 | |||
Unvaccinated | 30-34 | 1,130,675 | 101 | 424 | 525 | 46.4 | 37.5 | 8.9 | 13.1% | -1.5% | 74.4% |
double vaxxed | 30-34 | 480,574 | 11 | 183 | 194 | 40.4 | 38.1 | 2.3 | |||
Unvaccinated | 35-39 | 1,082,525 | 189 | 613 | 802 | 74.1 | 56.6 | 17.5 | 26.1% | 7.5% | 86.4% |
double vaxxed | 35-39 | 589,849 | 14 | 309 | 323 | 54.8 | 52.4 | 2.4 | |||
Unvaccinated | 40-44 | 939,699 | 239 | 898 | 1,137 | 121.0 | 95.6 | 25.4 | 28.1% | 13.8% | 82.0% |
double vaxxed | 40-44 | 720,804 | 33 | 594 | 627 | 87.0 | 82.4 | 4.6 | |||
Unvaccinated | 45-49 | 850,696 | 503 | 1,510 | 2,013 | 236.6 | 177.5 | 59.1 | 41.6% | 26.0% | 88.5% |
double vaxxed | 45-49 | 852,707 | 58 | 1,120 | 1,178 | 138.2 | 131.3 | 6.8 | |||
Unvaccinated | 50-54 | 758,182 | 928 | 2,372 | 3,300 | 435.3 | 312.9 | 122.4 | 52.0% | 36.0% | 92.8% |
double vaxxed | 50-54 | 1,129,045 | 100 | 2,261 | 2,361 | 209.1 | 200.3 | 8.9 | |||
Unvaccinated | 55-59 | 699,511 | 1,430 | 3,362 | 4,792 | 685.1 | 480.6 | 204.4 | 48.7% | 30.8% | 90.9% |
double vaxxed | 55-59 | 1,194,925 | 222 | 3,976 | 4,198 | 351.3 | 332.7 | 18.6 | |||
Unvaccinated | 60-64 | 539,511 | 2,184 | 4,366 | 6,550 | 1214.1 | 809.3 | 404.8 | 52.2% | 31.7% | 93.1% |
double vaxxed | 60-64 | 1,107,106 | 311 | 6,116 | 6,427 | 580.5 | 552.4 | 28.1 | |||
Unvaccinated | 65-69 | 378,356 | 2,785 | 5,381 | 8,166 | 2158.3 | 1422.2 | 736.1 | 56.9% | 37.7% | 94.1% |
double vaxxed | 65-69 | 1,030,612 | 451 | 9,126 | 9,577 | 929.3 | 885.5 | 43.8 | |||
Unvaccinated | 70-74 | 305,728 | 3,909 | 7,297 | 11,206 | 3665.4 | 2386.8 | 1278.6 | 58.3% | 39.0% | 94.5% |
double vaxxed | 70-74 | 1,128,526 | 798 | 16,431 | 17,229 | 1526.7 | 1456.0 | 70.7 | |||
Unvaccinated | 75-79 | 166,159 | 4,741 | 7,628 | 12,369 | 7444.1 | 4590.8 | 2853.3 | 65.1% | 45.7% | 96.1% |
double vaxxed | 75-79 | 896,876 | 992 | 22,338 | 23,330 | 2601.3 | 2490.6 | 110.6 | |||
Unvaccinated | 80-84 | 76,113 | 5,501 | 7,915 | 13,416 | 17626.4 | 10399.0 | 7227.4 | 73.7% | 57.2% | 97.4% |
double vaxxed | 80-84 | 677,380 | 1,277 | 30,126 | 31,403 | 4636.0 | 4447.4 | 188.5 | |||
Unvaccinated | 85-89 | 49,226 | 6,126 | 8,662 | 14,788 | 30041.0 | 17596.4 | 12444.6 | 72.5% | 54.8% | 97.6% |
double vaxxed | 85-89 | 422,042 | 1,237 | 33,571 | 34,808 | 8247.5 | 7954.4 | 293.1 | |||
Unvaccinated | 90+ | 34,169 | 6,836 | 10,550 | 17,386 | 50882.4 | 30875.9 | 20006.4 | 65.0% | 44.3% | 97.1% |
double vaxxed | 90+ | 236,443 | 1,371 | 40,685 | 42,056 | 17787.0 | 17207.1 | 579.8 |
The expose has already covered the disastrous figures for 10-14 and 15-19 year olds. And these will be a gross underestimate of the true scale of the disaster.
But it is quite incredible to me that the Office for Nefarious Statistics could print such total garbage for those over 35. The idea that a vaccine against one particular variant of Covid19 can decrease non Covid19 mortality by 57.2% in 80-84 years old is a very very sick joke, that cannot have been written without the creative assistance of The Office of Statistical Regulation.
Is the vaccine a cure for Cancer and heart Disease? Does it prevent Diabetes and Alzheimers? Behold, the ONS has cured all disease and halved all cause mortality. Yea we are all going to live twice as long due to the vaccines!
What has happened here is that the ONS has lost 100% of its all cause MORALITY. It is covering up vaccine side effect deaths with laughably false figures. For comparison, here are the all cause mortality figures for January1 to October22 for England.
https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/deaths/bulletins/deathsregisteredweeklyinenglandandwalesprovisional/22october2021
The only times during the 10 months when all cause mortality dropped below the 5 year average were the bank holidays when nobody was at work to count up the deaths. The wonderful improvements in mortality amongst the vaccinated just did not exist.
The prize for the most fraudulent statistics in the history of Covid must go to the state of Virginia in the good ole US of A. Here is their offering to convince Virginians to have their genome hacked by Pfizer and Moderna.
Look at that. Pfizer themselves say (Albert Bourla their CEO, in an interview with Yahoo Finance) that 2 doses of the vaccine have “very limited protection, if any” against the Omicron variant.
But not so in Virginia. There the 'fully' vaccinated are doing 34.2x better than the unvaxxed. That corresponds to a vaccine efficiency of 97.1%, even better than Pfizer claimed for Wuhan Hu1. Look at the wonderful dark blue line for the double vaxxed. They brushed off Covid19 like it was a horsefly. But the unvaccinated, WOW, they are being infected in their thousands.
Whereas a study from Sheba's medical centre in Israel found that 2 full doses of the Pfizer-BioNTech Covid-19 vaccine are not effective at all against the Omicron variant of the coronavirus, but a third “booster” shot helps, said Dr. Gili Regev-Yochay, director of the Infectious Disease Epidemiology Unit at Sheba Medical Center, at a Saturday night Zoom press conference (2021December11).
In cooperation with the Health Ministry’s Central Virology Lab at Sheba, the study compared bloodwork from 20 Sheba healthcare workers who received two doses five or six months ago (but not a third dose) with another 20 who received the booster one month ago.
“We compared the ability to neutralize the Omicron from these sets of bloods and we have good news and bad news,” said Regev-Yochay.
“The bad news is that people who received the second dose five or six months ago do not have any neutralization ability whatsoever against the Omicron, while they do have some against the Delta and much more, even, against the wild [original] type,” she said. “That is very worrisome.”
- https://www.israel21c.org/2-pfizer-doses-cant-fight-omicron-but-booster-helps/
Readers of the Expose will know that the Australian, Original German, Early US, Danish, Scottish and English figures all show a worse than -60% negative vaccine efficiency against Omicron and that this negative efficiency, is due to immune system degradation caused by VAIDS.
It seems that truth seekers are doomed to spend the rest of our lives proving that government statistics are lies designed to push a lethal drug, in the desperate hope that we might save just one of our brainwashed friends or relatives from disability and death. This would include the entire CDC wonder database, which would also have us believe that there are absolutely no deaths from vaccine side effects.
All these government lies are for the purpose of hiding the truth about the vaccines in order to protect the big lie.
4. Merciless Repression of the Truth and of Truth Publishers.
One cannot give an informed consent to vaccination unless and until one has heard both sides of the argument for and against the intervention. Everyone knows that in a court case, both sides of the argument are presented as fully and exhaustively and as forcefully as each other. Anything less than that is unjust and prejudice and corrupt. Today we see news outfits and social media outfits deplatforming those who do not share their particular orthodoxy
They call true arguments against their orthodoxy 'misinformation', whilst themselves peddling misinformation to support their orthodoxy
They ban and deplatform anyone who strays outside their orthodoxy or who attacks it as false - especially if their arguments are self evidently correct and valid.
This is the modern equivalent of excommunication and the Spanish Inquisition, fear of which causes vomit inducing public recantations being broadcast by celebrities eager to keep their status with the media. Every Orthodoxy exists to suppress the truth and to further the interests of the stakeholders in that orthodoxy. The Covid Orthodoxy is more widespread even than Catholicism, the founder of Orthodoxy in the realm of Christianity. Indeed the Catholic Orthodoxy supports the Vaccine Orthodoxy.
"The CIA owns everyone of any significance in the major media" (William Colby 1920 - 1996 - director of the CIA during the extraordinarily successful Watergate cover up involving a full and total failure of the US security services, from 1973-1976.)
We know that the words of Colby were true (notwithstanding the plethora of intelligence agency inspired websites dishonestly proclaiming the opposite) because that cover up worked other than in the cases of Woodward and Bernstein, who were rookie journalists at the Washington Post, not at the time considered to be persons of any significance in the major media.
In 1973, the media was owned by the Intelligence services. These "Services" are more powerful today in 2022 than they ever were in 1973, thanks to electronic surveillance technology. So as we all know 'the news' from mainstream media is nothing of the sort. There was no article printed in any newspaper in wartime Germany that did not get approved by Goebbel's Office. The same will be true today for many main stream media outfits.
What that means is that the BBC, the Times, the Daily Mail, the Guardian, the Independent, the Telegraph etc, however good their journalists are at finding the truth, are prohibited from publishing their findings if they undermine the orthodoxy that Vaccines are Safe and Effective. So instead of the news, we hear that Mrs Smyth-Granger-Tomlinson from Land's End died because she failed to get vaccinated and now all her children are orphans, in circumstances where vaccinated Mrs Smith from next door died from accelerated metastatic breast cancer whist her vaccinated son collapsed from myocarditis whilst playing football and her daughter stopped menstruating 6 months ago just after taking the vaccine. But we shall never hear about the Smith family, because they show the orthodoxy to be false
A democracy cannot function unless all political sides of a debate are given equal air time, in the papers, on the TV, on the net and on the radio.
Any politician who attempts to silence or deplatform his opponent is a traitor to democracy and should be banned from politics for an electoral term.
Any journalist or media outfit that seeks to deplatform his or its competitors on any grounds is not a newspaper but is an antidemocratic propaganda outfit bought and paid for by the owners of an orthodoxy
Any social media company that bans or silences any viewpoint that in itself is not a criminal offence is likewise antidemocratic and not a social media company but an antisocial media company, and a propaganda outfit for an orthodoxy
Yet that is what they all do and that is what they all are. They have all become traitors to democracy. They are, propaganda offices for the coming globalist coup d'etat, They are the enemy of their entire customer bases. They are snakes posing as canaries. They are hypocrites, who abuse the freedom of the press to lobby for the enslavement of all those who would disagree with press orthodoxy.
5. High status echo chambers
Prince Harry: "Until every community can access the vaccine and until every community is connected to trustworthy information about the vaccine, then we are all at risk."
Obviously his statement was worded by a lawyer. But it is the reverse of the truth. Only communities that can access the vaccines are at risk and those connected to trustworthy information about the vaccine would not need such access.
Guardian Newspaper: Concern for UK security as Anti vaxxer groups evolve toward US style militias 2022January15 - Lets demonise all 80,000 medical staff who refuse vaccines due to having proper medical training, as domestic terrorists shall we?
A greater concern to UK security is vaccine injury which has the capability to destroy what is left of the health service, especially if vaccine injury deniers keep spreading their misinformation.
Here is a quote from a classic hit piece in the Guardian Newspaper Opinion from 2021August9
What should we do about people who refuse to get vaccinated, or who continue to deny that Covid is real? Debate on this issue has raged for months in the US. “Respect them!” scolded conservative commentators. “Shame them!” urged some. Others counselled empathy for them as victims of disinformation.
But as the surging Delta variant ushers in the “pandemic of the unvaccinated”, uncertainty about persuading pandemic holdouts has given way to anger and despair. This was exemplified by the recent public reaction to a viral news video showing a Louisiana man recovering from a severe Covid-19 infection in a hospital bed, stating that he would still rather have had to be in hospital than accept a vaccine. It was the first time many of us saw the human face of a puzzling phenomenon which healthcare workers have been telling us about since last year: patients denying the realities of the virus even as they lay sick and dying from it.
The entire quote is an ad hominem attack on vaccine refusers, equating them with flat earthers who deny that covid is real. Yes, (hahaha) these antivaxxers are so stupid that they deny (haha) the existence of Covid even as they (ha) lie dying from it. The lousianan luminary did not say he did not believe in Covid. He said he'd rather be in hospital than accept a vaccine. He was saying he trusts his immune system and the hospital staff more that he trusts Pfizer and Moderna. But notice that there is not one shred of scientific evidence in the quote or indeed in the entire article - https://www.theguardian.com/commentisfree/2021/aug/09/convince-anti-vaxxers
I'll bet there are plenty of Covid deniers who got vaccinated so they could keep their job or go on holiday or visit their elderly parents in care homes. Where is the evidence that Covid deniers are all antivaxxers?
The Louisiana man will never need to worry about Covid again in his life because natural immunity gives him antibodies to the nucleocapsid covid proteins (a fancy name for the protein case containing the nucleic acid of the virus, the RNA). This gives him 8x broader immunity than a vaccination and his immunity will not wane with time. He is over it. Whereas many of the the vaccinated are condemned to be reinfected ad infinitum and worse..
How about the unvaxxed 40,000 care staff and the 80,000 unvaxxed NHS staff who work with Covid every day. Do they deny it is real too? Are they morons as well? Or does their medical training tell them something that Guardian readers perhaps ought to know something about before they destroy their immune systems and alter their genetic code for the financial benefit of Big Pharma, when they turn themselves into fear addicted RNA junkies. Who would have thought that a left wing rag would side with a couple of corrupt drugs companies over the human rights of all their readers? Oh how the mighty are fallen, and all over a couple of flu shots.
I have to say that I thank the Expose from the bottom of my heart for giving me a platform from which to respond to the Guardian It is a freedom I never thought I would be given in this world.
It is a simple question. The answer should be obvious. But it is actually a very difficult subject to understand for modern man. Nearly every large corporation today has a Modern Slavery Statement. We all accept that slavery is bad. But what is a slave if it is not someone who does not own their own body? The body of a slave is owned by his master. His master can use or abuse that body at will. Furthermore the children of a slave are not owned by the slave, Because the slave does not own his own body which produces the children. The children of a slave are owned by the master of that slave.
Let me explain what modern slavery is. It is slavery to the state. The state determines what your children will learn at school and parents do not need to be informed what their children are being taught because it is none of their business. Why is it none of their business? Because the state believes it owns your children. The state determines what medications your children will take and in which hospital they will take them. The state gets to decide when and if a ventilator is turned on or off for your children, The state gets to decide when and if your older relatives are nil by mouth and filled up with Midazolam with a DNR order stuck on their bed. And now the state wishes to decide for you that you shall take the Covid vaccines, by denying you access to arguments against vaccination, which are far more forceful, when given the light of day, than those for it.
All of this is not a coincidence. It is a pattern of behaviour that declares that the government believes it owns your body, your child's body and your granny's body, which means you and your whole family are its slaves.
Yes Pfizer and Moderna have created a monopoly which is in the process of destroying at the least, the first level of defence of the immune systems in all Covid vaccinated mankind, so that they indefinitely get sick but never die, making them into the perfect customers for their shareholders. But that is only the first trailer. It is not the big picture.
Yes, the WEF through assorted mega tech corporations is seeking to establish a new global government, which usurps the power and authority and sovereignty of every democratically elected government. And they will achieve this through vaccine passports linked to social credit scores, the mark of the Beast and the Image of the Beast. But that is only the second trailer. It is still not the big picture.
The vaccine RNA differs from the Wuhan Hu1 virus RNA as follows -
https://en.wikipedia.org/wiki/Moderna_COVID-19_vaccine
https://mottikumar3.medium.com/reverse-engineering-the-source-code-of-the-biontech-pfizer-sars-cov-2-vaccine-d3503a34f95f
1. It has a known human a 5' UTR (5 prime untranslated region) and a known human 3' UTR (3 prime untranslated region) which are human RNA from the alpha globin gene. These regions lead and follow individual protein coding sequences in the 4101 base (nucleotide) mRNA strand.
2. All the Uridine bases (U) are swapped for pseudouridine bases (Ψ).
This is a hack which prevents the immune system from recognising the RNA as RNA and therefore destroying it. The Pseudouridine acts like Uridine and produces the same proteins, But it effectively deceives the immune system into believing that vaccine RNA is not genetic material and therefore poses no hacking threat.
This means that the RNA persists and is not broken down within 48 hours like normal RNA.
3. In order to achieve longer life and more replications, vaccine RNA is terminated with a sequence of multiple A bases (Adenine). These tend to drop off with replication. The optimum number of them is around 120. The vaccine spike protein has 30 then a link then 70. This link format looks like a way of extending its replicating life for as long as possible.
4. We know that the spike proteins bind to the P53 gene which is the essential tumour suppression gene. P53 checks your DNA before it replicates and it makes sure that its fixed - Dr Ryan Cole (5 hours into the Covid19 a Second Opinion Senate Hearing under Senator Ron Johnson).
One cannot link to Senator Ron Johnson's video enough times - Covid-19 A Second Opinion hosted by Senator Ron Johnson - A MUST SEE DISCUSSION.
Jiang found that the vaccine RNA enters into cell nuclei (which in itself is a disaster that is as dangerous as reverse transcription, where mRNa writes itself into the DNA in the cell nucleus, which makes the genetic code in the mRNA permanent in the cell) and there it inhibits DNA repair -- https://www.mdpi.com/1999-4915/13/10/2056/htm
So putting the jigsaw together, we have vaccine mRNA which is designed to hack our immune system (using pseudouridine rather than uridine) and then switches off our DNA repair gene. What does that say to you? Plainly it is changing our genes and preventing us from fixing that change. Furthermore it is designed to persist indefinitely in the cell and reproduce as many times as possible. So it is attempting to execute a permanent change to our genes. That turns us into Genetically Modified Humans, GMO humans, like GMO wheat. If people knew that in advance they would not have taken the vaccine. There is the lack of true vaccine information. It is one thing to eat GMO wheat. It is another to be injected with an agent which turns you into a GMO human.
The Astra Zenca vaccine actually states that it contains GMOs...
One dose (0.5 ml) of the Oxford Astra Zeneca vaccine for Vaccitech contains:
"
COVID-19 Vaccine (ChAdOx1-S* recombinant) 5 × 1010 viral particles (50 Billion copies of spike protein DNA)
Recombinant, replication-deficient chimpanzee adenovirus vector encoding the SARS CoV 2 Spike (S)
glycoprotein. Produced in genetically modified human embryonic kidney (HEK) 293 cells.
This product contains genetically modified organisms (GMOs)." - https://www.cambridge-news.co.uk/news/uk-world-news/covid-19-what-ingredients-oxfordastrazeneca-19538759
Nobody owns a patent on natural wheat. But Monsanto owns patents on genetically modified wheat (MON 71800). Nobody owns a patent on a natural mouse. But Regeneron own patents on genetically modified mice (HK-1174783-A1).
"Since the 1980 case of Diamond v. Chakrabarty, in which the U.S. Supreme Court ruled that a living microorganism is patentable, the U.S. Patent and Trademark Office has determined that plants and nonhuman animals can be patented" - https://pubmed.ncbi.nlm.nih.gov/8505268/. .
Vaccines turn you into a GMO Human. That is something which in theory is patentable. The NIH has a patent on Covid19, which they purchased from the University of North Carolina in 2018
2002: April 19: The University of North Carolina files US patent 7279327 for an infectious replication defective coronavirus (to be used as a virus vector for an HIV vaccine), claiming priority from US28531801P. Inventors were: Kristopher M. Curtis, Boyd Yount, Ralph S. Baric
2018: US Patent 7279327 for the chimeric adaption of the naturally occurring animal SARS Coronavirus to become infectious to humans targeting lung epithelial cells is transferred from University of North Carolina to he US National Institute for Health (NIH) - who funded it in the first place.
So taking a genetic vaccine potentially sells your body into slavery to the NIH who own the patent not merely on the spike protein, but actually the entire Covid19 virus..
So when Jesus said: What benefits a man if he gains the whole world (through a vaccine Passport) but loses his soul (it becoming owned by NIH and those who control that institute). He was giving us a warning.
If you see a debate wherein one side is persecuting silencing and repressing the other, how hard is it to deduce which side has the truth? These vaccines are a con, a financial con, a political con and a genetic con. The expose is trying to be your firewall to stop you getting hacked by bad actors by conquering the lie with the truth.
Here is how serious this all is. We predict 62.3 million excess cardiovascular deaths in 2022 due to the vaccines. The death rate is presently doubling every 3 months. So in 2023 there would be 16x as many excess deaths as there were in 2022, which is 996.8 million. So the total number of heart attack deaths in the next 2 years is predicted to be 1,059,100,000. This excludes death from VAIDS and its complications, from nuerodegenerative diseases, from accelerating cancers, from faster progressing type2 diabetes etc. etc. These projections are dependent upon spike production continuing at the present rate. We can now predict from these figures, that if you continue to be regularly boosted with the present vaccine your life expectancy is no more than 3 years. If you are boosted with the new Omicron vaccine that period could be longer or shorter we do not know. If you stop at 2 jabs, you may perhaps recover before your 3 years runs out depending upon which cells got hit with the vaccine.
This projection will be true if spike production continues at a constant rate in your cells and if you take no therapeutics. If you start to treat the spike proteins, with the normal flccc protocol, then you may defeat the vaccines. There needs to be a test developed for spike proteins in the blood. But there again that might scare people off taking more shots. So will they produce one?
THE WRITER RECOMMENDS THAT ALL VACCINATED PEOPLE INVESTIGATE AND TREAT SPIKE PROTEIN PRODUCTION ASAP
To enslave you they must appropriate your body. To do that they must own some part of your genes. To do that they must permanently alter your genes and prevent your immune system for fixing the change. That is what the vaccines do. Now what genetic change would Satan like to make to your genes? He would like to turn you from the seed of Holy Spirit, the woman of Genesis 3:15, to the seed of the serpent, who was Cain initially. He does that through the snake bite of Genesis 3:15, Double vaccination, a fang for a jab. The boosters reinforce it and make sure your immune system cannot reverse it, by winning the war against your vaccinated cells.
Meanwhile, God is trying to take us out of Adam into Abraham in order to begin the process of ending age and adamic death. But Satan is not prepared to let God have a clear run at that. So he is trying to beat him to the punch and take us out of Adam and into Cain in order to keep his control over us and deny us our non ageing edenic salvation that Jesus died for.
Cain means spear or spike in Hebrew. Strong's has: !yIq; qayin, kah´-yin; from 6969 !Wq in the orig. sense of fixity; a lance (as striking fast):—spear.
So vaccinated people are spikian, spearian, lancian, Cainian, the seed of the Serpent. That is the really big lie.
____________________________
How the vaccinated become GMO humans
Everything you ever wanted to know about the genetics of vaccination, but were afraid to ask for fear of being cancelled by facebook, youtube, twitter, paypal, instagram, spotify and umpteeen misled celebrities, musicians and venue hosts who think that genes are made by Levi Straus.
Our story begins in 1869 when the young Swiss physician Friedrich Miescher was looking for the building blocks of life in white blood cells (Leucocytes). It was thought at the time that our inherited characteristics were stored in proteins. But Miescher discovered a strange and enigmatic molecule which was definitely not a protein in our white blood cells. It resided in their nuclei. Hence he called it Nuclein. He first published his discovery in 1871 and theorised that this Nuclein could carry the hereditary information of mankind in some kind of alphabet. He had in fact stumbled across DNA. But he was not able to prove its role in the human body during his life. For that proof, mankind had to wait for the arrival of Avery, MacLeod, and McCarty, who in 1944 proved that DNA was the biochemical in our bodies that determined our inherited characteristics, not proteins as had been thought in the previous scientific orthodoxy.
This precipitated a race to determine the chemical structure of DNA. A race which was won by Francis Crick and James Watson.
On April 25th 1953, 4 years before I was born, Crick and Watson of Cambridge University, published their famous discovery of the base pairing internal structure on the Double Helix backbone of DNA which had previously been X ray photographed by Maurice Wilkins and Rosalind Franklin of Kings College London. They relied on the Chargaff rule that in DNA the amount of Guanine was equal to the amount of Cytosine and the amount of Thymine was equal to the amount of Adenine. From this they deduced that the Guanine paired with the Cytosine and the Thymine paired with the Adenine and both pairings were joined by bonds between the Hydrogen atoms in the bases (bases because they are alkali rather than acid, not bases because they have something built upon them or are full of military personnel). DNA is a beautiful structure which houses the genetic information necessary to build an entire human being in 3 Giga Bases, 3 billion base pairs. Its brilliance is that all the information is stored twice, in each complementary strand. So by breaking the bond between the Hydrogen atoms of the base pairs and unzipping itself, it can then act as a template to produce a single stranded DNA type polymer, which is called RNA. So DNA is self replicating and dually redundant. Since there are 4 possible bases, life has a 4 bit code. So the entire genome of mankind is 12 Gigabits or 1.5 GigaBytes in size. It is therefore more than 12x smaller than the 20GB Microsoft Windows 10 operating system and yet has enough information within it to build an entire human starting only from one cell and to keep that human going for 100 years without needing to reboot him once!
The double Helix backbone is made out of Phosphate groups (the yellow PO4 groups above) and Ribose sugars (the blue Pentagons above)
All DNA and RNA and fake RNA (modified RNA, pseudo RNA) is made entirely from these 5 atoms: C, O, H, N, P.
C is Carbon
O is Oxygen
H is Hydrogen
N is Nitrogen
P is Phosphorus
The 4 bases of DNA (Adenine Guanine Cytosine and Thymine) when attached to a Deoxyribose sugar are called nucleosides. Then when attached further to a Phosphate group they are called nucleotides. A Deoxy Ribose sugar is a Ribose sugar where a Hydroxy (OH) group has been replaced by a Hydrogen (H) atom. So one Oxygen atom has been lost - hence Deoxy.
Nucleic Acid | Base (Nucleobase) | Nucleoside (Base + Ribose) | Nucleotide (Base + Ribose + Phosphate) |
RNA | Adenine (A) | Adenosine | Adenosine-5'-monophosphate or adenylate (AMP) |
Cytosine (C) | Cytidine | Cytidine-5'-monophosphate or cytidylate (CMP) | |
Guanine (G) |
Guanosine | Guanosine-5'-monophosphate or guanylate (GMP) | |
Uracil (U) | Uridine | Uridine-5'-monophosphate or uridylate (UMP) | |
Fake RNA | Uracil | Pseudouridine (Ψ) | Pseudouridine-5'-monophosphate or pseudo uridylate (ΨMP) |
Uracil | N1 Methylpseudouridine (m1Ψ) | N1 Methylpseudouridine-5'-monophosphate or N1 Methylpseudouridylate (m1ΨMP) | |
Nucleic Acid | Base (Nucleobase) | Nucleoside (Base + Deoxyribose) | Nucleotide (Base + Deoxyrbiose + Phosphate) |
DNA | Adenine (A) |
Deoxyadenosine |
Deoxyadenosine-5'-monophosphate or deoxyadenylate (dAMP) |
Cytosine (C) | Deoxycytidine | Deoxycytidine-5'-monophosphate or deoxycytidylate (dCMP) | |
Guanine (G) | Deoxyguanosine | Deoxyguanosine-5'-monophosphate or deoxyguanylate (dGMP) | |
Thymine (T) | Deoxythymidine |
Deoxythymidine-5'-monophosphate or thymidylate (dTMP) |
The 5 bases A, G, C, T, U are called Canonical, rather like the books of the bible which are accepted as being true inspired scripture are called Canonical. Whereas Pseudouridine (Ψ) and N1 Methylpseudouridine (m1Ψ) are non canonical. They are Pseudepigrapha in scriptural terms or Genetically modified in secular terms.
So DNA is a polymer chain of deoxyribose nucleotides and RNA is a chain of ribose nucleotides. .From a chemist's standpoint, whereas the bases are alkaline, the phosphate groups are acidic, being derived from Phosphoric acid (OH-)3P=O, by replacing 2 hydroxy groups with Ribose sugars. The bases, when paired, lose much of their alkalinity hence the finished nucleotide polymer is acidic, DeoxyriboNucleic Acid or RiboNucleic Acid.
5', pronounced 5 prime, is the 5th Carbon atom in the ribose sugar counting clockwise from the 1st or prime Carbon atom which is bonded to the base.
With that brief introduction we are now in a position to study some of the literature on MODIFIED mRNA vaccines and make a better informed decision as to whether they should be taken. mRNA is an abbreviation not for Modified RNA but for Messenger RNA. So these vaccines are not mRNA vaccines as advertised. They are Modified mRNA vaccines, genetically modified mRNA vaccines, GMO vaccines. We must remember that Moderna stands for MODifiEd RNA.
The HQ of a cell is the cell nucleus. The product catalogue of the cell is the DNA which resides only in the cell nucleus. The protein manufacturing facilities in the cell are called Ribosomes. These churn out the proteins of which you and your cells are made. The instructions for those proteins, their amino acid sequences, and how they should fold themselves in 3D space are contained in your DNA. in your cell nucleus. The nucleus uses RNA to copy parts of your DNA and send that copy to the ribosomes. So mRNA, messenger RNA, is essentially an email from your HQ to your production facility foreman. Having read the email, the ribosomes then make the specified protein and the mRNA is destroyed by your cell (the email is deleted),
Here is a more detailed view of the translation from mRNA to protein that occurs in the ribosome after the transcription from DNA to mRNA that occurs in the nucleus.
Each group of 3 bases codes for one amino acid which is transported to the ribosome by tRNA, transfer RNA. The hamburger shaped ribosome is essentially an amino acid polymerisation unit which reads its sequencing instructions from the mRNA. That is how incredibly intricate and delicate and precise the biological processes of life are.
Canonical RNA, containing Uracil as the 4th base, is degraded by the cell 2 minutes after production. This is the equivalent of the ribosome foreman recycling the email after having read it.
We all know that RNA is short-lived having an average lifespan of only two minutes. And, that DNA has a life-span of about 6.8 million years, after which all the bonds would be broken. Thus, uracil being unstable is appropriate for RNA, because stability doesn’t matter for RNA as it is very short-lived. Whereas Thymine is very appropriate for DNA where maintaining the genetic sequence with very high stability is necessary - https://onlyzoology.com/why-uracil-is-present-in-rna-and-thymine-in-dna/
Nature/God wastes nothing and recycles everything. What we do not want is discarded emails building up in the cell and turning it into an RNA rubbish tip. Also if the mRNA is not degraded then the cell ribosomes will continue to make the same protein from it and the cell will not be able to produce the other proteins it needs. This is why natural unmodified mRNA is degraded within 2 minutes of its production.
Here is the chemical structure of the Pfizer vaccine modified RNA - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8043204/ The sooner you can see the whole picture the better.
The blue area are the bases coding for the protein spike lifted from the Wuhan HU1 (alpha) protein spike and prescribed by the WHO. The first two green bases GA are the 5' starting cap of the RNA chain and the last 110 Adenines with a GACU insert after 30 of them in pink are the poly(A) 3' ending cap The large number of As extends the life of the mRNA and enables it to make more spike proteins, since the Adenines tend to drop off with increased use.
The caps are followed by UTRs (untranslated regions). These Untranslated regions are parts of the RNA message which do not get translated into proteins but contain other instructions for the Ribosomes (the protein factories in your cells). Pfizer uses the human UTR of the alpha globin gene (which is known to work well for protein production) before the front cap, the 5' cap. It uses a less well understood and longer human UTR (in white) before the end cap, the 3' cap,. But whose genetic code are we getting in that UTR?
Each triplet (Codon) of bases codes for one amino acid on the final protein. The Wuhan Hu1 (alpha) spike protein has 1273 amino acids, which requires 1273 codons or 3819 bases.
Here is the synthetic pathway for replacing Uracil with N1 Methylpseudouridine in the Vaccine mRNA...
Pseudouridylase and Nep1 are enzymes which facilitate their respective conversions from natural Uridine to fake Uridine.
Curevac N.V of Tubingen Germany decided to make a vaccine out of natural unmodified mRNA. Whereas Pfizer and Moderna changed all of the Uracil (U)s in the genetic code of their spike protein vaccine to be N1 Methylpseudouridine (m1Ψ)s.
Both vaccine types used the same lipid nanoparticle delivery system (Acuitas ALC-0315). The main difference between them was the decision to genetically modify the RNA or not.
On 16 June 2021,[5] CureVac said its vaccine showed 47% efficacy from its Phase IIb/III trial. Later, the final result data showed an efficacy of 48% against symptomatic disease in all age groups and, for people aged 18 to 60 years, an efficacy of 53% against symptomatic disease, 77% against moderate and severe disease and 100% against hospitalization and death, as no cases were detected in the study]. This was based on interim analysis of 134 COVID cases in its Phase III study conducted in Europe and Latin America.
Regrettably Curevac did not have enough cases to determine in a statistically significant manner the vaccine effectiveness for the over 60s against hospitalisation and death. But here is what they did determine
100% efficacy against hospitalisation and death for those between 18-60 (but only 48% against infection)
Whereas Pfizer demonstrated 95% efficacy against infection and 99.9% against death (Pfizer lost 15 out of 22,000) - https://www.nejm.org/doi/10.1056/NEJMoa2110345
We absolutely know that Pfizer did not offer 100% efficacy against either hospitalisation or death for 18-60 year olds from the real world results of their vaccinations. I strongly suspect that the true Pfizer results were initially better but ended up being worse than the CureVac results 6 months after vaccination (and we all hope to live for at least 6 months after vaccination).
In the event Curevac gave up because Pfizer's clinical trial results were on the face of it a lot better at preventing infection. We have subsequently discovered that viral loads in the vaccinated from July 2021 onward were as high or higher than in the unvaccinated. So actually Pfizer is not very good at preventing infection. Furthermore the efficacy of Pfizer vaccine reduces over time due to immune system destruction, which would not have been so pronounced with the natural RNA vaccines due to their lower dosage (12 ug for CureVac, 30ug for Pfizer, 100ug for Moderna) and due to the very rapid cellular degradation of the natural mRNA of Curevac. So there would not have been this incessant spike protein production that we are seeing with the Genetically Modified fake RNA vaccines.
What is totally fascinating to the writer is that 12 ug of a natural vaccine RNA which disappears in 2 minutes (natural CureVac mRNA) is half as efficient as 30ug or 100ug of the genetically modified fake RNA which persists as we shall discover for at least 6 months. This confirms for me something that I have always suspected (it being predicted in scripture at Genesis 3:15) that the vaccine doses and the longevity of their spike protein productions have nothing whatsoever to do with protection against covid and everything to do with permanent genome appropriation.
The Modified mRNA is invisible to the cellular defences. Your immune system does not see m1Ψ RNA as genetic material. So it does not recycle it. It does not degrade it. Also the modified RNA is more resistant to being degraded if by some miracle your cell does detect it as foreign or just due to time and temperature. Furthermore it hypes up protein production to make as many spikes as possible. This does give a short term advantage to the immune system. But it is treating the immune system like a moron. Once it has seen the spike protein for a few days and determined it to be a dangerous pathogen, it does not need to see more and more spike proteins every day.
Diminishing the activity of innate immune sensors = Evading the cells antivirus protection.
Improving the translational capacity = Making more Spikes
Increasing the protection of the RNA against nucleases = Preventing the cell from breaking the modified mRNA down, in the unlikely event that it gets recognised for what it is.
Uracil is put where thymine would ordinarily be during DNA to RNA transcription. Because uracil is short-lived and can break down into cytosine, most animals do not employ it in their DNA. However, because RNA is a short-lived molecule, uracil is the chosen nucleotide - https://www.vedantu.com/biology/difference-between-nucleotide-and-nucleoside
We all know that RNA is short-lived having an average lifespan of only two minutes. And, that DNA has a life-span of about 6.8 million years, after which all the bonds would be broken. Thus, uracil being unstable is appropriate for RNA, because stability doesn’t matter for RNA as it is very short-lived. Whereas Thymine is very appropriate for DNA where maintaining the genetic sequence with very high stability is necessary - https://onlyzoology.com/why-uracil-is-present-in-rna-and-thymine-in-dna/
When pseudouridine is used in place of uridine in synthetic mRNA, the modified mRNA molecule arouses less response from Toll-like receptors, a part of the human immune system that would otherwise identify the mRNA as unwelcome. This makes pseudouridine useful in mRNA vaccines, including the mRNA COVID-19 vaccines. This property of pseudouridine was discovered by Katalin Karikó and Drew Weissman in 2005. N1-Methylpseudouridine provides even less innate immune response than Ψ, as well as improving translation capacity. Both Pfizer-BioNTech and Moderna mRNA vaccines therefore use N1-Methylpseudouridine rather than Ψ.- https://en.wikipedia.org/wiki/Pseudouridine
So in short, contrary to the official narrative, Pfizer and Moderna have done everything humanly possible to ensure that their products are not vaccines which TEMPORARILY present the spike antigen to your immune system and then clear off. No, they are a permanent gene hack by immune system evading genetically modified mRNA which boosts spike production and which persists by every means known to man for as long as possible and certainly for 6 months as can be seen from the study below.
Bruce K. Patterson published an article in June 2021 presenting the evidence that the spike protein is detectable in non-classical monocytes, whose half-life is mere 7 days, for up to 15 months post Covid-19 infection in some “Long Covid” patients. But, according to Dr. Robert Malone’s tweets back in July, in the course of this study they were picking randomly six healthy “controls” out of healthy vaccinated individuals. To their astonishment, all six had S spikes in their monocytes 6 months after their vaccination, with one “control” having S spikes in 15% of monocytes! Which means that S spikes linger around or get freshly produced in the vaccinated for 6+ months, contrary to the official narrative that S spikes are cleared within 2 weeks of the jab! - https://live2fightanotherday.substack.com/p/does-mrna-in-jabs-really-produce
N1 Methylpseudouridine (m1Ψ) makes vaccine RNA more or less permanent lasting for at least 6 months rather than 2 minutes, which is the lifespan of natural mRNA. Then we must consider that the human body has between has 30-37 trillion cells in it (wikipedia) depending upon how they are counted. So we have 30-37 trillion copies of our own DNA. But after one Pfizer jab or one Moderna Jab we also have 14.4 trillion or 48 trillion copies respectively of fairly permanent genetically modified fake vaccine mRNA. So in the case of Moderna, we have more instruction leaflets telling us to make spike proteins than we have genetic bibles telling us to make ourselves! And that is just from one jab. This is not a small intervention to present an antigen to our immune system. It is a wholesale takeover of our cellular construction team.
But there is a further problem which may be the biggest of them all. If the body never breaks down these genetically modified fake RNA genes then we are condemned to have heart attacks, organ failures, neurodegenerative diseases and cancers until we keel over. Which is bad enough. But if our body wins the battle and breaks down all of this invading fake RNA, it will release pseudo uracils everywhere. These will then become incorporated in all of our mRNA in our cells and that mRNA will itself start lasting for 6 months rather than disappearing after 2 minutes. This will mean that our cells will fill up with far too much of the proteins that they generally make. The very super powers of increase production and degradation aversion that Pfizer imbued their spike protein mRNA with, will be transferred to all our other mundane cellular protein production efforts, and we will kill ourselves with huge quantities of totally unnecessary protein overproduction.
This N1 Methylpseudouridine (m1Ψ) which we will have in absolutely massive quantity, will mean that every time our nucleic DNA asks for a few thousand proteins from a ribosome it will be given a few billion of them and will not be able to turn off their production. This could be a nuclear genetic time bomb, actually more of a ribosomal genetic time bomb.
Which is the better? To suffer the slings and arrows of incessant spike protein production resulting from undegraded vaccine RNA or to drown in a sea of unstoppable protein production resulting from the fake uridylate out of the degraded vaccine RNA?
A further problem is that by speeding up spike protein production and by using a fake U base, you increase the chances of translation errors and incorrectly folded proteins, which are known to cause all sorts of ghastly diseases...
However, Ψ wobbles more in base-pairing than U and can pair not only with A and G, but also, to a lesser extent, with C and U. This is likely to increase misreading of a codon by a near-cognate tRNA. When nucleotide U in stop codons was replaced by Ψ, the rate of misreading of a stop codon by a near-cognate tRNAs increased. Such readthrough events would not only decrease the number of immunogenic proteins (accurately copied spike proteins), but also produce a longer protein of unknown fate with potentially deleterious effects - https://live2fightanotherday.substack.com/p/does-mrna-in-jabs-really-produce .
So you will get all sorts of incorrect and too long proteins clogging up the works.
Worse still, all this semi permanent fake mRNA created from methylated Pseudouridines resulting from broken down vaccine mRNA will be undetectable to our immune system as genetic material. So we shall have no way of recognising that we even have a problem let alone fixing it.
Finally I would simply say to all the people who have wisely decided to refrain from eating genetically modified food. If you have taken an mRNA covid vaccine you yourself may be more genetically modified than the food you refuse to eat..
_____________________________
The Chairman of the South African Medical Association. Dr. Angelique Coetzee, discovered the Omicron variant in South Africa in November 2021. Being a practicing GP during a pandemic, she saw plenty of Omicron cases and deduced from these that it lead to a mild form of the flu. The term 'mild' is very specific in medicine. Dr Coetzee explains what she means by the term to the German Die Welt newspaper as follows...
“I am a clinician and based on the clinical picture there are no indications that we are dealing with a very serious disease. The course is mostly mild. I’m not saying you won’t get sick if you’re mild,”
“The definition of mild COVID-19 disease is clear, and it is a [World Health Organization] definition: patients can be treated at home and oxygen or hospitalization is not required,”
“A serious illness is one in which we see acute pulmonary respiratory infections: people need oxygen, maybe even artificial respiration. We saw that with Delta—but not with Omicron. So I said to people, ‘I can’t say it like that because it’s not what we’re seeing.'”
So according to the discoverer of Omicron, the chairperson of the South African Medical Association, Omicron is a mild form of the flu which did not cause hospitalisation or require oxygen and was not an acute respiratory infection like Delta. Of course this is not what the gene corrupting drug pushers want you to hear. So she went on to reveal that 'European officials' pressurized her to deny this truth.
“I was told not to publicly state that it was a mild illness. I have been asked to refrain from making such statements and to say that it is a serious illness. I declined,”
Coetzee did not specify which officials told her to keep quiet. She did say that South African officials did not try to pressure her. She claimed that she was criticized by authorities in both the United Kingdom and the Netherlands.
Dr Coetzee explains... “What I said at one point—because I was just tired of it—was: In South Africa, this is a mild illness, but in Europe, it is a very serious one. That’s what your politicians wanted to hear.”
These things were reported in several news sources on February10.
South Africa was 23% fully vaccinated in November 2021. So this means that Omicron is a mild flu for the unvaccinated. It does not cause hospitalisation and does not require oxygen and does not result in acute respiratory infection like Delta. And furthermore this is being covered up by European governments.
South Africa, being in the Southern Hemisphere, is in Summer during November (our May). We know that mild flue does not send people to hospital in May in any numbers. So this means that all those who do go to hospital with Omicron in Australia (another Southern Hemisphere country) for example, are not vaccinated. They must be the fully vaccinated and suffering from VAIDS in order to make it into hospital with flu during summer. We first saw full blown VAIDS in the New South Wales (NSW) figures for Omicron cases from 2022January1-8...
There we saw a 2,085 to 194.4 or 10.72 to 1 case rate ratio and a 159,325 to 787 or 202.5:to 1 case ratio. In other words 99.5% of their Omicron cases were in the fully vaccinated and one half of one percent of cases were in the unvaccinated. But the minute these figures were published by the Expose on January28, the State Government started rigging them to cover up the vaccine generated catastrophe as follows...
The unvaxxed Omicron cases went from 2,775 on Jan1 to 3,552 on Jan8 to 55,697
on Jan15 to 72,772 on Jan22 !
Whereas the doubly vaxxed Omicron cases went from 108,056 to 267,381 to 372,912 to 438, 255.
The Jan1 report was published on Jan13, the Jan8 report on Jan20, the Jan15 report on Feb1 and the Jan22 report on Feb4. The Jan8 report says that it was published on Feb4 which is garbage because we knew its contents before Jan28 and because its URL is .20220120 or Jan20, 2022 - DOH!
So by Feb8, the government of NSW had engineered a scenario where the 202.5 to 1 case ratio between the double dosed and the undosed had fallen to 65,343 to 68,128 or 0.95 to 1. There were now more Omicron cases in the unvaxxed than in the double vaxxed, notwithstanding the fact that 95% of NSW is double vaxxed! I think they overcooked that one a bit!
So in the first 2 weeks of the year you were 10x more likely to catch Omicron if you were vaxxed. But by the 3rd week, you were 20x more likely to catch it if you were unvaxxed.
That is the most obvious and sickening fraud by the Australian State government. The minute the Expose article pointed out that NSW government stats showed that vaccines were causing Australians to fall ill. The State government falsified their stats in the most amateur manner imaginable. They have now demonstrated publicly to the whole world, that the health of Australians is not as important to them as selling vaccines. Indeed that heartless administration has now become no different to any other gutter drug pusher that ever defiled the bodies of his victims for profit. This is the Australian arm of the Pfizergate Vaccine damage cover up. But it is by no means limited to Kangaropolis. Let's have a full look at Canada, the land of the Moose.
The Canadian government uses a multi stage cover up. Firstly it is almost impossible to get back issues of its Epidemiological summaries. The Australians make all their back issues available as links to pdfs. Not so the Canadians. They make nothing available other the the present report. But one can use the wayback machine of web.archive.org to get them with extreme difficulty. The way back machine spends 95% of its time giving you the last report it cached and refusing to give you the next report you have asked for (even if it has that report). If you wish to spend a few millennia wrestling with a really annoying AI please visit - https://web.archive.org/web/*/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
The machine is perfectly capable of failing to load a page at least 10x then loading 25% of it, then 50% of it, then 75% of it then forgetting what it has loaded and starting all over again. Better still it can give you an html page of its cases following vaccination section with the cases by vax table from one report and with the wording of the populations with various vaccination statuses from another report. Fortunately the population wording quotes figures from the cases table. So one can spot the mistake and match things up correctly. The pdfs it has stored are OK of course. But it was quite a jigsaw to put together. The whole story with the links is laid out in the Appendix to this article.
Secondly it gives cumulative figures dating back to the start of vaccination (or before that even). In this way the fine detail of the present week is hidden in amongst all the other weeks data since vaccination began in December 2020. We solve this by subtracting two cumulative figures ending on dates one week apart.
Thirdly and most cynically, they apply the European 2013 age standardising morality formula to case numbers and hospitalisations. Public Health Scotland does the same thing. It is an outright fraud. Yes death rates are heavily effected by the age of the patient. But cases rates are not. One cannot apply a mortality compensator to a statistic that does not involve mortality. THAT IS FRAUD PURE AND SIMPLE.
One might as well compensate the case rates with how good people are at cooking spaghetti in the different age bands. It would be no less valid.
So to get the unvaxxed case rates per 100k of unvaxxed population we first need the Population of Canada - https://statistique.quebec.ca/en/produit/tableau/population-by-age-group-canada-and-regions
38,246,108 total less 1,882,571 (aged 0-4) less 2,044,238 (aged 5-9) less 40%
of 2,091,276 (aged 10-14) or 836,510 = 33,482,789 aged 12 and over.
33,482,789. 33.5 million 12 years old and over to 1 decimal place.
36,363,537. 36.4 million 5 years old and over to 1 decimal place.
Oct 2 - https://web.archive.org/web/20211020075926/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Oct 9 - https://web.archive.org/web/20211027154438/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html#a9
Oct 9 - https://web.archive.org/web/20211102202548/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Oct 16 - https://web.archive.org/web/20211104153557/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Oct 23 - https://web.archive.org/web/20211112151805/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Oct 30 - https://web.archive.org/web/20211120122253if_/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Nov 6 - https://web.archive.org/web/20211128152117/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
(incorrectly labelled as Nov13)
Nov 6 - https://web.archive.org/web/20211128000628/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
(Nov6 pop Nov13 Cases)
Nov13 - https://web.archive.org/web/20211207205042/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Nov 20 - https://web.archive.org/web/20211211000508/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Nov 27 - https://web.archive.org/web/20211218044638/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Dec 4 - https://web.archive.org/web/20211223170506/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Dec 4 - https://web.archive.org/web/20211223231903/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Dec 11 - https://web.archive.org/web/20220103173009/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Dec 18 - https://web.archive.org/web/20220108083517/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Dec 25 - https://web.archive.org/web/20220117211207/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Jan 1 - https://web.archive.org/web/20220124194636/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Jan 8 - https://web.archive.org/web/20220201164337/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Jan 15 - https://web.archive.org/web/20220206015044/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Jan 22 - https://web.archive.org/web/20220209162204/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Here are all the figures by week from 2021October2 to 2022January22
Status | Pop | Case | Hosp | Death | Case Inc | Hosp Inc | Death Inc | Case rate | Hosp rate | Death rate | Immune Efficacy |
|
Oct-02 | Unvaccinated | 11,100,000 | 671,339 | 35,848 | 7,120 | |||||||
Cases not yet protected | 400,000 | 40,590 | 2,823 | 719 | ||||||||
Partially vaccinated | 1,800,000 | 46,083 | 2,919 | 681 | ||||||||
Fully vaccinated | 20,200,000 | 43,268 | 1,813 | 520 | ||||||||
Oct-09 | Unvaccinated | 10,900,000 | 678,410 | 36,579 | 7,264 | 7,071 | 731 | 144 | 64.87 | 6.71 | 1.32 | 60.2% |
Cases not yet protected | 400,000 | 41,278 | 2,859 | 730 | 688 | 36 | 11 | 172.00 | 9.00 | 2.75 | ||
Partially vaccinated | 1,700,000 | 47,230 | 2,968 | 691 | 1,147 | 49 | 10 | 67.47 | 2.88 | 0.59 | ||
Fully vaccinated | 20,500,000 | 48,555 | 2,035 | 608 | 5,287 | 222 | 88 | 25.79 | 1.08 | 0.43 | ||
Oct-16 | Unvaccinated | 10,800,000 | 683,875 | 37,318 | 7,381 | 5,465 | 739 | 117 | 50.60 | 6.84 | 1.08 | 54.6% |
Cases not yet protected | 300,000 | 41,737 | 2,905 | 737 | 459 | 46 | 7 | 153.00 | 15.33 | 2.33 | ||
Partially vaccinated | 1,600,000 | 48,216 | 3,039 | 700 | 986 | 71 | 9 | 61.63 | 4.44 | 0.56 | ||
Fully vaccinated | 20,800,000 | 53,330 | 2,265 | 676 | 4,775 | 230 | 68 | 22.96 | 1.11 | 0.33 | ||
Oct-23 | Unvaccinated | 10,600,000 | 688,473 | 37,837 | 7,482 | 4,598 | 519 | 101 | 43.38 | 4.90 | 0.95 | 52.2% |
Cases not yet protected | 300,000 | 42,054 | 2,923 | 738 | 317 | 18 | 1 | 105.67 | 6.00 | 0.33 | ||
Partially vaccinated | 1,600,000 | 49,028 | 3,081 | 707 | 812 | 42 | 7 | 50.75 | 2.63 | 0.44 | ||
Fully vaccinated | 21,000,000 | 57,684 | 2,482 | 733 | 4,354 | 217 | 57 | 20.73 | 1.03 | 0.27 | ||
Oct-30 | Unvaccinated | 10,500,000 | 691,361 | 37,742 | 7,540 | 2,888 | -95 | 58 | 27.50 | -0.90 | 0.55 | 29.3% |
Cases not yet protected | 300,000 | 42,321 | 2,883 | 741 | 267 | -40 | 3 | 89.00 | -13.33 | 1.00 | ||
Partially vaccinated | 1,400,000 | 49,670 | 3,015 | 710 | 642 | -66 | 3 | 45.86 | -4.71 | 0.21 | ||
Fully vaccinated | 21,300,000 | 61,825 | 2,610 | 776 | 4,141 | 128 | 43 | 19.44 | 0.60 | 0.20 | ||
Nov-06 | Unvaccinated | 10,500,000 | 695,396 | 38,751 | 7,651 | 4,035 | 1,009 | 111 | 38.43 | 9.61 | 1.06 | 40.9% |
Cases not yet protected | 100,000 | 42,539 | 2,957 | 749 | 218 | 74 | 8 | 218.00 | 74.00 | 8.00 | ||
Partially vaccinated | 1,400,000 | 50,261 | 3,165 | 717 | 591 | 150 | 7 | 42.21 | 10.71 | 0.50 | ||
Fully vaccinated | 21,500,000 | 66,709 | 2,900 | 837 | 4,884 | 290 | 61 | 22.72 | 1.35 | 0.28 | ||
Nov-13 | Unvaccinated | 10,400,000 | 699,046 | 39,245 | 7,715 | 3,650 | 494 | 64 | 35.10 | 4.75 | 0.62 | 33.2% |
Cases not yet protected | 100,000 | 42,723 | 2,970 | 749 | 184 | 13 | 0 | 184.00 | 13.00 | 0.00 | ||
Partially vaccinated | 1,200,000 | 50,789 | 3,210 | 722 | 528 | 45 | 5 | 44.00 | 3.75 | 0.42 | ||
Fully vaccinated | 21,800,000 | 71,822 | 3,102 | 881 | 5,113 | 202 | 44 | 23.45 | 0.93 | 0.20 | ||
Nov-20 | Unvaccinated | 10,300,000 | 702,434 | 39,637 | 7,790 | 3,388 | 392 | 75 | 32.89 | 3.81 | 0.73 | 29.2% |
Cases not yet protected | 200,000 | 42,876 | 2,977 | 751 | 153 | 7 | 2 | 76.50 | 3.50 | 1.00 | ||
Partially vaccinated | 1,100,000 | 51,277 | 3,230 | 724 | 488 | 20 | 2 | 44.36 | 1.82 | 0.18 | ||
Fully vaccinated | 21,900,000 | 76,925 | 3,310 | 933 | 5,103 | 208 | 52 | 23.30 | 0.95 | 0.24 | ||
Nov-27 | Unvaccinated | 10,200,000 | 705,725 | 39,967 | 7,861 | 3,291 | 330 | 71 | 32.26 | 3.24 | 0.70 | 21.6% |
Cases not yet protected | 200,000 | 43,022 | 2,988 | 752 | 146 | 11 | 1 | 73.00 | 5.50 | 0.50 | ||
Partially vaccinated | 1,000,000 | 51,728 | 3,258 | 731 | 451 | 28 | 7 | 45.10 | 2.80 | 0.70 | ||
Fully vaccinated | 22,100,000 | 82,513 | 3,514 | 981 | 5,588 | 204 | 48 | 25.29 | 0.92 | 0.22 | ||
Dec-04 | Unvaccinated | 9,900,000 | 709,123 | 40,287 | 7,917 | 3,398 | 320 | 56 | 34.32 | 3.23 | 0.57 | 18.3% |
Cases not yet protected | 400,000 | 43,114 | 3,000 | 753 | 92 | 12 | 1 | 23.00 | 3.00 | 0.25 | ||
Partially vaccinated | 1,000,000 | 52,116 | 3,277 | 734 | 388 | 19 | 3 | 38.80 | 1.90 | 0.30 | ||
Fully vaccinated | 22,200,000 | 88,742 | 3,705 | 1,017 | 6,229 | 191 | 36 | 28.06 | 0.86 | 0.16 | ||
Dec-18 | Unvaccinated | 9,400,000 | 727,925 | 40,788 | 8,013 | 18,802 | 501 | 96 | 100.01 | 2.66 | 0.51 | 23.9% |
Cases not yet protected | 500,000 | 43,471 | 3,062 | 759 | 357 | 62 | 6 | 35.70 | 6.20 | 0.60 | ||
Partially vaccinated | 1,200,000 | 53,171 | 3,374 | 744 | 1,055 | 97 | 10 | 43.96 | 4.04 | 0.42 | ||
Fully vaccinated | 22,400,000 | 122,843 | 4,099 | 1,077 | 34,101 | 394 | 60 | 76.12 | 0.88 | 0.13 | ||
Dec-25 | Unvaccinated | 9,300,000 | 728,415 | 41,089 | 8,076 | 490 | 301 | 63 | 5.27 | 3.24 | 0.68 | -98.8% |
Cases not yet protected | 300,000 | 43,754 | 3,077 | 761 | 283 | 15 | 2 | 94.33 | 5.00 | 0.67 | ||
Partially vaccinated | 1,400,000 | 54,772 | 3,402 | 748 | 1,601 | 28 | 4 | 114.36 | 2.00 | 0.29 | ||
Fully vaccinated | 22,500,000 | 219,445 | 4,569 | 1,131 | 96,602 | 470 | 54 | 429.34 | 2.09 | 0.24 | ||
Jan-01 | Unvaccinated | 9,200,000 | 741,789 | 41,561 | 8,149 | 13,374 | 472 | 73 | 145.37 | 5.13 | 0.79 | -75.9% |
Cases not yet protected | 200,000 | 44,037 | 3,092 | 762 | 283 | 15 | 1 | 141.50 | 7.50 | 0.50 | ||
Partially vaccinated | 1,600,000 | 56,831 | 3,453 | 754 | 2,059 | 51 | 6 | 128.69 | 3.19 | 0.38 | ||
Fully vaccinated | 22,500,000 | 354,940 | 5,657 | 1,253 | 135,495 | 1,088 | 122 | 602.20 | 4.84 | 0.54 | ||
Jan-08 | Unvaccinated | 9,100,000 | 758,702 | 42,412 | 8,285 | 16,913 | 851 | 136 | 185.86 | 9.35 | 1.49 | -66.2% |
Cases not yet protected | 200,000 | 44,274 | 3,103 | 765 | 237 | 11 | 3 | 118.50 | 5.50 | 1.50 | ||
Partially vaccinated | 1,800,000 | 59,073 | 3,554 | 766 | 2,242 | 101 | 12 | 124.56 | 5.61 | 0.67 | ||
Fully vaccinated | 22,600,000 | 479,143 | 7,592 | 1,565 | 124,203 | 1,935 | 312 | 549.57 | 8.56 | 1.38 | ||
Jan-15 | Unvaccinated | 11,800,000 | 771,095 | 43,540 | 8,479 | 12,393 | 1,128 | 194 | 105.03 | 9.56 | 1.64 | -76.8% |
Cases not yet protected | 300,000 | 44,494 | 3,118 | 770 | 220 | 15 | 5 | 73.33 | 5.00 | 1.67 | ||
Partially vaccinated | 1,600,000 | 61,209 | 3,717 | 788 | 2,136 | 163 | 22 | 133.50 | 10.19 | 1.38 | ||
Fully vaccinated | 22,600,000 | 581,635 | 10,387 | 2,032 | 102,492 | 2,795 | 467 | 453.50 | 12.37 | 2.07 | ||
Jan-22 | Unvaccinated | 11,700,000 | 892,033 | 44,907 | 8,693 | 120,938 | 1,367 | 214 | 1,033.66 | 11.68 | 1.83 | 71.6% |
Cases not yet protected | 300,000 | 50,695 | 3,154 | 775 | 6,201 | 36 | 5 | 2,067.00 | 12.00 | 1.67 | ||
Partially vaccinated | 1,700,000 | 79,683 | 3,925 | 808 | 18,474 | 208 | 20 | 1,086.71 | 12.24 | 1.18 | ||
Fully vaccinated | 22,700,000 | 648,271 | 13,043 | 2,490 | 66,636 | 2,656 | 458 | 293.55 | 11.70 | 2.02 |
Here are the raw cumulative data from the Epidemiological-summary-of-COVID-19-cases produced by the Canadian Government from 2021October2 to 2022January22
Status | Population | Cases | Hospitalisations | Deaths | |
Oct-02 | Unvaccinated | 11,100,000 | 671,339 | 35,848 | 7,120 |
Cases not yet protected | 400,000 | 40,590 | 2,823 | 719 | |
Partially vaccinated | 1,800,000 | 46,083 | 2,919 | 681 | |
Fully vaccinated | 20,200,000 | 43,268 | 1,813 | 520 | |
Oct-09 | Unvaccinated | 10,900,000 | 678,410 | 36,579 | 7,264 |
Cases not yet protected | 400,000 | 41,278 | 2,859 | 730 | |
Partially vaccinated | 1,700,000 | 47,230 | 2,968 | 691 | |
Fully vaccinated | 20,500,000 | 48,555 | 2,035 | 608 | |
Oct-16 | Unvaccinated | 10,800,000 | 683,875 | 37,318 | 7,381 |
Cases not yet protected | 300,000 | 41,737 | 2,905 | 737 | |
Partially vaccinated | 1,600,000 | 48,216 | 3,039 | 700 | |
Fully vaccinated | 20,800,000 | 53,330 | 2,265 | 676 | |
Oct-23 | Unvaccinated | 10,600,000 | 688,473 | 37,837 | 7,482 |
Cases not yet protected | 300,000 | 42,054 | 2,923 | 738 | |
Partially vaccinated | 1,600,000 | 49,028 | 3,081 | 707 | |
Fully vaccinated | 21,000,000 | 57,684 | 2,482 | 733 | |
Oct-30 | Unvaccinated | 10,500,000 | 691,361 | 37,742 | 7,540 |
Cases not yet protected | 300,000 | 42,321 | 2,883 | 741 | |
Partially vaccinated | 1,400,000 | 49,670 | 3,015 | 710 | |
Fully vaccinated | 21,300,000 | 61,825 | 2,610 | 776 | |
Nov-06 | Unvaccinated | 10,500,000 | 695,396 | 38,751 | 7,651 |
Cases not yet protected | 100,000 | 42,539 | 2,957 | 749 | |
Partially vaccinated | 1,400,000 | 50,261 | 3,165 | 717 | |
Fully vaccinated | 21,500,000 | 66,709 | 2,900 | 837 | |
Nov-13 | Unvaccinated | 10,400,000 | 699,046 | 39,245 | 7,715 |
Cases not yet protected | 100,000 | 42,723 | 2,970 | 749 | |
Partially vaccinated | 1,200,000 | 50,789 | 3,210 | 722 | |
Fully vaccinated | 21,800,000 | 71,822 | 3,102 | 881 | |
Nov-20 | Unvaccinated | 10,300,000 | 702,434 | 39,637 | 7,790 |
Cases not yet protected | 200,000 | 42,876 | 2,977 | 751 | |
Partially vaccinated | 1,100,000 | 51,277 | 3,230 | 724 | |
Fully vaccinated | 21,900,000 | 76,925 | 3,310 | 933 | |
Nov-27 | Unvaccinated | 10,200,000 | 705,725 | 39,967 | 7,861 |
Cases not yet protected | 200,000 | 43,022 | 2,988 | 752 | |
Partially vaccinated | 1,000,000 | 51,728 | 3,258 | 731 | |
Fully vaccinated | 22,100,000 | 82,513 | 3,514 | 981 | |
Dec-04 | Unvaccinated | 9,900,000 | 709,123 | 40,287 | 7,917 |
Cases not yet protected | 400,000 | 43,114 | 3,000 | 753 | |
Partially vaccinated | 1,000,000 | 52,116 | 3,277 | 734 | |
Fully vaccinated | 22,200,000 | 88,742 | 3,705 | 1,017 | |
Dec-18 | Unvaccinated | 9,400,000 | 727,925 | 40,788 | 8,013 |
Cases not yet protected | 500,000 | 43,471 | 3,062 | 759 | |
Partially vaccinated | 1,200,000 | 53,171 | 3,374 | 744 | |
Fully vaccinated | 22,400,000 | 122,843 | 4,099 | 1,077 | |
Dec-25 | Unvaccinated | 9,300,000 | 728,415 | 41,089 | 8,076 |
Cases not yet protected | 300,000 | 43,754 | 3,077 | 761 | |
Partially vaccinated | 1,400,000 | 54,772 | 3,402 | 748 | |
Fully vaccinated | 22,500,000 | 219,445 | 4,569 | 1,131 | |
Jan-01 | Unvaccinated | 9,200,000 | 741,789 | 41,561 | 8,149 |
Cases not yet protected | 200,000 | 44,037 | 3,092 | 762 | |
Partially vaccinated | 1,600,000 | 56,831 | 3,453 | 754 | |
Fully vaccinated | 22,500,000 | 354,940 | 5,657 | 1,253 | |
Jan-08 | Unvaccinated | 9,100,000 | 758,702 | 42,412 | 8,285 |
Cases not yet protected | 200,000 | 44,274 | 3,103 | 765 | |
Partially vaccinated | 1,800,000 | 59,073 | 3,554 | 766 | |
Fully vaccinated | 22,600,000 | 479,143 | 7,592 | 1,565 | |
Jan-15 | Unvaccinated | 11,800,000 | 771,095 | 43,540 | 8,479 |
Cases not yet protected | 300,000 | 44,494 | 3,118 | 770 | |
Partially vaccinated | 1,600,000 | 61,209 | 3,717 | 788 | |
Fully vaccinated | 22,600,000 | 581,635 | 10,387 | 2,032 | |
Jan-22 | Unvaccinated | 11,700,000 | 892,033 | 44,907 | 8,693 |
Cases not yet protected | 300,000 | 50,695 | 3,154 | 775 | |
Partially vaccinated | 1,700,000 | 79,683 | 3,925 | 808 | |
Fully vaccinated | 22,700,000 | 648,271 | 13,043 | 2,490 |
Here are the cases, hospitalisations and deaths by vaccine status by week (except for the 14 day period from Dec4-18 wherein Dec11 was omitted due it being prepared around Christmas presumably). These are deduced from the table above by subtracting one weeks cumulative figures from the previous weeks cumulative figures. Then we deduce the case rate, the hospital visit rate and the death rate per 100k from the population figures in column2. Then we deduce the Immune/Vaccine efficiency percentage using the normalised case rate ratio formula of Pfizer.
Status | Pop | Cases | Hospital Visits |
Deaths | Case rate | Hospital rate | Death rate | Immune Efficacy |
Oct2-9 | (12+) | |||||||
No Dose | 10,900,000 | 7,071 | 731 | 144 | 64.87 | 6.71 | 1.32 | 60.2% |
1 Dose <14 days | 400,000 | 688 | 36 | 11 | 172.00 | 9.00 | 2.75 | |
1 Dose 14+ days | 1,700,000 | 1,147 | 49 | 10 | 67.47 | 2.88 | 0.59 | |
2 Doses | 20,500,000 | 5,287 | 222 | 88 | 25.79 | 1.08 | 0.43 | |
Oct9-16 | (12+) | |||||||
No Dose | 10,800,000 | 5,465 | 739 | 117 | 50.60 | 6.84 | 1.08 | 54.6% |
1 Dose <14 days | 300,000 | 459 | 46 | 7 | 153.00 | 15.33 | 2.33 | |
1 Dose 14+ days | 1,600,000 | 986 | 71 | 9 | 61.63 | 4.44 | 0.56 | |
2 Doses | 20,800,000 | 4,775 | 230 | 68 | 22.96 | 1.11 | 0.33 | |
Oct16-23 | (12+) | |||||||
No Dose | 10,600,000 | 4,598 | 519 | 101 | 43.38 | 4.90 | 0.95 | 52.2% |
1 Dose <14 days | 300,000 | 317 | 18 | 1 | 105.67 | 6.00 | 0.33 | |
1 Dose 14+ days | 1,600,000 | 812 | 42 | 7 | 50.75 | 2.63 | 0.44 | |
2 Doses | 21,000,000 | 4,354 | 217 | 57 | 20.73 | 1.03 | 0.27 | |
Oct23-30 | (12+) | |||||||
No Dose | 10,500,000 | 2,888 | -95 | 58 | 27.50 | -0.90 | 0.55 | 29.3% |
1 Dose <14 days | 300,000 | 267 | -40 | 3 | 89.00 | -13.33 | 1.00 | |
1 Dose 14+ days | 1,400,000 | 642 | -66 | 3 | 45.86 | -4.71 | 0.21 | |
2 Doses | 21,300,000 | 4,141 | 128 | 43 | 19.44 | 0.60 | 0.20 | |
Oct30-Nov6 | (12+) | |||||||
No Dose | 10,500,000 | 4,035 | 1,009 | 111 | 38.43 | 9.61 | 1.06 | 40.9% |
1 Dose <14 days | 100,000 | 218 | 74 | 8 | 218.00 | 74.00 | 8.00 | |
1 Dose 14+ days | 1,400,000 | 591 | 150 | 7 | 42.21 | 10.71 | 0.50 | |
2 Doses | 21,500,000 | 4,884 | 290 | 61 | 22.72 | 1.35 | 0.28 | |
Nov6-13 | (12+) | |||||||
No Dose | 10,400,000 | 3,650 | 494 | 64 | 35.10 | 4.75 | 0.62 | 33.2% |
1 Dose <14 days | 100,000 | 184 | 13 | 0 | 184.00 | 13.00 | 0.00 | |
1 Dose 14+ days | 1,200,000 | 528 | 45 | 5 | 44.00 | 3.75 | 0.42 | |
2 Doses | 21,800,000 | 5,113 | 202 | 44 | 23.45 | 0.93 | 0.20 | |
Nov13-20 | (12+) | |||||||
No Dose | 10,300,000 | 3,388 | 392 | 75 | 32.89 | 3.81 | 0.73 | 29.2% |
1 Dose <14 days | 200,000 | 153 | 7 | 2 | 76.50 | 3.50 | 1.00 | |
1 Dose 14+ days | 1,100,000 | 488 | 20 | 2 | 44.36 | 1.82 | 0.18 | |
2 Doses | 21,900,000 | 5,103 | 208 | 52 | 23.30 | 0.95 | 0.24 | |
Nov20-27 | (12+) | |||||||
No Dose | 10,200,000 | 3,291 | 330 | 71 | 32.26 | 3.24 | 0.70 | 21.6% |
1 Dose <14 days | 200,000 | 146 | 11 | 1 | 73.00 | 5.50 | 0.50 | |
1 Dose 14+ days | 1,000,000 | 451 | 28 | 7 | 45.10 | 2.80 | 0.70 | |
2 Doses | 22,100,000 | 5,588 | 204 | 48 | 25.29 | 0.92 | 0.22 | |
Nov27-Dec4 | (12+) | |||||||
No Dose | 9,900,000 | 3,398 | 320 | 56 | 34.32 | 3.23 | 0.57 | 18.3% |
1 Dose <14 days | 400,000 | 92 | 12 | 1 | 23.00 | 3.00 | 0.25 | |
1 Dose 14+ days | 1,000,000 | 388 | 19 | 3 | 38.80 | 1.90 | 0.30 | |
2 Doses | 22,200,000 | 6,229 | 191 | 36 | 28.06 | 0.86 | 0.16 | |
Dec4-18 | (12+) | |||||||
No Dose | 9,400,000 | 18,802 | 501 | 96 | 100.01 | 2.66 | 0.51 | 23.9% |
1 Dose <14 days | 500,000 | 357 | 62 | 6 | 35.70 | 6.20 | 0.60 | |
1 Dose 14+ days | 1,200,000 | 1,055 | 97 | 10 | 43.96 | 4.04 | 0.42 | |
2 Doses | 22,400,000 | 34,101 | 394 | 60 | 76.12 | 0.88 | 0.13 | |
Dec18-25 | (12+) | |||||||
No Dose | 9,300,000 | 490 | 301 | 63 | 5.27 | 3.24 | 0.68 | -98.8% |
1 Dose <14 days | 300,000 | 283 | 15 | 2 | 94.33 | 5.00 | 0.67 | |
1 Dose 14+ days | 1,400,000 | 1,601 | 28 | 4 | 114.36 | 2.00 | 0.29 | |
2 Doses | 22,500,000 | 96,602 | 470 | 54 | 429.34 | 2.09 | 0.24 | |
Dec25-Jan1 | (12+) | |||||||
No Dose | 9,200,000 | 13,374 | 472 | 73 | 145.37 | 5.13 | 0.79 | -75.9% |
1 Dose <14 days | 200,000 | 283 | 15 | 1 | 141.50 | 7.50 | 0.50 | |
1 Dose 14+ days | 1,600,000 | 2,059 | 51 | 6 | 128.69 | 3.19 | 0.38 | |
2 Doses | 22,500,000 | 135,495 | 1,088 | 122 | 602.20 | 4.84 | 0.54 | |
Jan1-8 | (12+) | |||||||
No Dose | 9,100,000 | 16,913 | 851 | 136 | 185.86 | 9.35 | 1.49 | -66.2% |
1 Dose <14 days | 200,000 | 237 | 11 | 3 | 118.50 | 5.50 | 1.50 | |
1 Dose 14+ days | 1,800,000 | 2,242 | 101 | 12 | 124.56 | 5.61 | 0.67 | |
2 Doses | 22,600,000 | 124,203 | 1,935 | 312 | 549.57 | 8.56 | 1.38 | |
Jan8-15 | (5+) | |||||||
No Dose | 11,800,000 | 12,393 | 1,128 | 194 | 105.03 | 9.56 | 1.64 | -76.8% |
1 Dose <14 days | 300,000 | 220 | 15 | 5 | 73.33 | 5.00 | 1.67 | |
1 Dose 14+ days | 1,600,000 | 2,136 | 163 | 22 | 133.50 | 10.19 | 1.38 | |
2 Doses | 22,600,000 | 102,492 | 2,795 | 467 | 453.50 | 12.37 | 2.07 | |
Jan15-22 | (5+) | |||||||
No Dose | 11,700,000 | 120,938 | 1,367 | 214 | 1,033.66 | 11.68 | 1.83 | 71.6% |
1 Dose <14 days | 300,000 | 6,201 | 36 | 5 | 2,067.00 | 12.00 | 1.67 | |
1 Dose 14+ days | 1,700,000 | 18,474 | 208 | 20 | 1,086.71 | 12.24 | 1.18 | |
2 Doses | 22,700,000 | 66,636 | 2,656 | 458 | 293.55 | 11.70 | 2.02 |
Here are the cases, hospitalisations and deaths by vaccine status by week (except for the 14 day period from Dec4-18 wherein Dec11 was omitted due it being prepared around Christmas presumably). These are deduced from the table above by subtracting one weeks cumulative figures from the previous weeks cumulative figures. Then we deduce the case rate, the hospital visit rate and the death rate per 100k from the population figures in column2. Then we deduce the Immune/Vaccine efficiency percentage using the normalised case rate ratio formula of Pfizer.
Status | Pop | Cases | Hospital Visits |
Deaths | Case rate | Hospital rate | Death rate | Immune Efficacy |
Oct2-9 | (12+) | |||||||
No Dose | 10,900,000 | 7,071 | 731 | 144 | 64.87 | 6.71 | 1.32 | 60.2% |
1 Dose <14 days | 400,000 | 688 | 36 | 11 | 172.00 | 9.00 | 2.75 | |
1 Dose 14+ days | 1,700,000 | 1,147 | 49 | 10 | 67.47 | 2.88 | 0.59 | |
2 Doses | 20,500,000 | 5,287 | 222 | 88 | 25.79 | 1.08 | 0.43 | |
Oct9-16 | (12+) | |||||||
No Dose | 10,800,000 | 5,465 | 739 | 117 | 50.60 | 6.84 | 1.08 | 54.6% |
1 Dose <14 days | 300,000 | 459 | 46 | 7 | 153.00 | 15.33 | 2.33 | |
1 Dose 14+ days | 1,600,000 | 986 | 71 | 9 | 61.63 | 4.44 | 0.56 | |
2 Doses | 20,800,000 | 4,775 | 230 | 68 | 22.96 | 1.11 | 0.33 | |
Oct16-23 | (12+) | |||||||
No Dose | 10,600,000 | 4,598 | 519 | 101 | 43.38 | 4.90 | 0.95 | 52.2% |
1 Dose <14 days | 300,000 | 317 | 18 | 1 | 105.67 | 6.00 | 0.33 | |
1 Dose 14+ days | 1,600,000 | 812 | 42 | 7 | 50.75 | 2.63 | 0.44 | |
2 Doses | 21,000,000 | 4,354 | 217 | 57 | 20.73 | 1.03 | 0.27 | |
Oct23-30 | (12+) | |||||||
No Dose | 10,500,000 | 2,888 | -95 | 58 | 27.50 | -0.90 | 0.55 | 29.3% |
1 Dose <14 days | 300,000 | 267 | -40 | 3 | 89.00 | -13.33 | 1.00 | |
1 Dose 14+ days | 1,400,000 | 642 | -66 | 3 | 45.86 | -4.71 | 0.21 | |
2 Doses | 21,300,000 | 4,141 | 128 | 43 | 19.44 | 0.60 | 0.20 | |
Oct30-Nov6 | (12+) | |||||||
No Dose | 10,500,000 | 4,035 | 1,009 | 111 | 38.43 | 9.61 | 1.06 | 40.9% |
1 Dose <14 days | 100,000 | 218 | 74 | 8 | 218.00 | 74.00 | 8.00 | |
1 Dose 14+ days | 1,400,000 | 591 | 150 | 7 | 42.21 | 10.71 | 0.50 | |
2 Doses | 21,500,000 | 4,884 | 290 | 61 | 22.72 | 1.35 | 0.28 | |
Nov6-13 | (12+) | |||||||
No Dose | 10,400,000 | 3,650 | 494 | 64 | 35.10 | 4.75 | 0.62 | 33.2% |
1 Dose <14 days | 100,000 | 184 | 13 | 0 | 184.00 | 13.00 | 0.00 | |
1 Dose 14+ days | 1,200,000 | 528 | 45 | 5 | 44.00 | 3.75 | 0.42 | |
2 Doses | 21,800,000 | 5,113 | 202 | 44 | 23.45 | 0.93 | 0.20 | |
Nov13-20 | (12+) | |||||||
No Dose | 10,300,000 | 3,388 | 392 | 75 | 32.89 | 3.81 | 0.73 | 29.2% |
1 Dose <14 days | 200,000 | 153 | 7 | 2 | 76.50 | 3.50 | 1.00 | |
1 Dose 14+ days | 1,100,000 | 488 | 20 | 2 | 44.36 | 1.82 | 0.18 | |
2 Doses | 21,900,000 | 5,103 | 208 | 52 | 23.30 | 0.95 | 0.24 | |
Nov20-27 | (12+) | |||||||
No Dose | 10,200,000 | 3,291 | 330 | 71 | 32.26 | 3.24 | 0.70 | 21.6% |
1 Dose <14 days | 200,000 | 146 | 11 | 1 | 73.00 | 5.50 | 0.50 | |
1 Dose 14+ days | 1,000,000 | 451 | 28 | 7 | 45.10 | 2.80 | 0.70 | |
2 Doses | 22,100,000 | 5,588 | 204 | 48 | 25.29 | 0.92 | 0.22 | |
Nov27-Dec4 | (12+) | |||||||
No Dose | 9,900,000 | 3,398 | 320 | 56 | 34.32 | 3.23 | 0.57 | 18.3% |
1 Dose <14 days | 400,000 | 92 | 12 | 1 | 23.00 | 3.00 | 0.25 | |
1 Dose 14+ days | 1,000,000 | 388 | 19 | 3 | 38.80 | 1.90 | 0.30 | |
2 Doses | 22,200,000 | 6,229 | 191 | 36 | 28.06 | 0.86 | 0.16 | |
Dec4-18 | (12+) | |||||||
No Dose | 9,400,000 | 18,802 | 501 | 96 | 100.01 | 2.66 | 0.51 | 23.9% |
1 Dose <14 days | 500,000 | 357 | 62 | 6 | 35.70 | 6.20 | 0.60 | |
1 Dose 14+ days | 1,200,000 | 1,055 | 97 | 10 | 43.96 | 4.04 | 0.42 | |
2 Doses | 22,400,000 | 34,101 | 394 | 60 | 76.12 | 0.88 | 0.13 | |
Dec18-25 | (12+) | |||||||
No Dose | 9,300,000 | 490 | 301 | 63 | 5.27 | 3.24 | 0.68 | -98.8% |
1 Dose <14 days | 300,000 | 283 | 15 | 2 | 94.33 | 5.00 | 0.67 | |
1 Dose 14+ days | 1,400,000 | 1,601 | 28 | 4 | 114.36 | 2.00 | 0.29 | |
2 Doses | 22,500,000 | 96,602 | 470 | 54 | 429.34 | 2.09 | 0.24 | |
Dec25-Jan1 | (12+) | |||||||
No Dose | 9,200,000 | 13,374 | 472 | 73 | 145.37 | 5.13 | 0.79 | -75.9% |
1 Dose <14 days | 200,000 | 283 | 15 | 1 | 141.50 | 7.50 | 0.50 | |
1 Dose 14+ days | 1,600,000 | 2,059 | 51 | 6 | 128.69 | 3.19 | 0.38 | |
2 Doses | 22,500,000 | 135,495 | 1,088 | 122 | 602.20 | 4.84 | 0.54 | |
Jan1-8 | (12+) | |||||||
No Dose | 9,100,000 | 16,913 | 851 | 136 | 185.86 | 9.35 | 1.49 | -66.2% |
1 Dose <14 days | 200,000 | 237 | 11 | 3 | 118.50 | 5.50 | 1.50 | |
1 Dose 14+ days | 1,800,000 | 2,242 | 101 | 12 | 124.56 | 5.61 | 0.67 | |
2 Doses | 22,600,000 | 124,203 | 1,935 | 312 | 549.57 | 8.56 | 1.38 | |
Jan8-15 | (5+) | |||||||
No Dose | 11,800,000 | 12,393 | 1,128 | 194 | 105.03 | 9.56 | 1.64 | -76.8% |
1 Dose <14 days | 300,000 | 220 | 15 | 5 | 73.33 | 5.00 | 1.67 | |
1 Dose 14+ days | 1,600,000 | 2,136 | 163 | 22 | 133.50 | 10.19 | 1.38 | |
2 Doses | 22,600,000 | 102,492 | 2,795 | 467 | 453.50 | 12.37 | 2.07 | |
Jan15-22 | (5+) | |||||||
No Dose | 11,700,000 | 120,938 | 1,367 | 214 | 1,033.66 | 11.68 | 1.83 | 71.6% |
1 Dose <14 days | 300,000 | 6,201 | 36 | 5 | 2,067.00 | 12.00 | 1.67 | |
1 Dose 14+ days | 1,700,000 | 18,474 | 208 | 20 | 1,086.71 | 12.24 | 1.18 | |
2 Doses | 22,700,000 | 66,636 | 2,656 | 458 | 293.55 | 11.70 | 2.02 |
One of the funny things that comes out of this data is thar the unvaxxed celebrate Christmas and nobody else does! Either that or Jesus protected the unvaxxed from Omicron over Christmas! Because only the blue line (unvaxxed) goes to Zero during the Christmas week and then bounces back actually above the purple line (single vaxxed). The blue line does slightly better than the purple line until Omicron first hits in December. This is because 1 dose does not cause VAIDS. The red line (double vaxxed) does better than everybody until Omicron, when it becomes a disaster movie. That is VAIDS. The vaccines do have some effectiveness against Delta, but none against Omicron.
This graph is a great demonstrator of Immune system degradation from 60% to 20%
in 10 weeks. Then Omicron kicks in and woops, we go to minus 98.8% in the Christmas week (because unvaxxed people celebrate Christmas more than vaxxed as we can see from the line graph above). Then we stabilise at around minus 75%. In the meantime, the Expose on January28 published an article using Canadian Government statistics to prove the progression of VAIDS in the doubly vaccinated. The Canadian government then rigged their figures for the week from Jan15-22 (which figures were produced in February) in an absurd attempt to disprove VAIDS. They also deleted the pdf dated 2022January21, which I relied upon for the stats in the original piece - https://www.canada.ca/content/dam/phac-aspc/documents/services/diseases/2019-novel-coronavirus-infection/surv-covid19-weekly-epi-update-20220121-en.pdf
In the pre-Christmas week when Omicron stuck in Canada, vaccine efficiency as measured by the normalised case rate ratio between the doubly vaxxed and the unvaxxed (which is how Pfizer measured it in their seminal Phase III vaccine trial) went from +23.8% to -98.8%. There was a -23.8% Christmas factor to these figures, which then stabilised at -75%. This occurred because the miniscule initial vaccine efficiency against Omicron is very soon obliterated by the 4% of remaining immune system reduction each week in the doubly vaxxed. Omicron uncloaked this immune degradation. But for the immune system to recover and for the vaccines to suddenly become better against Omicron than they were against Delta in one week, in circumstances where the CEO of Pfizer, Albert Bourla, has stated to Yahoo finance that 2 doses of his vaccine offer “very limited protection, if any” against Omicron is totally absurd. And that is the Canadian Government is asking us to believe. It is an insult to everyone with more than two unvaccinated brain cells. That is the Canadian arm of the Pfizergate cover up.
The Robert Koch Institut in Berlin, owned by the German Federal Ministry of Health, produced statistics on December30, 2021 which on page 14 of the weekly Covid19 management report for week 51 (from Monday December20 to Sunday December26) showed...
The unvaxxed had 186 Omicron cases and made up 26.5% of the population
The doubly vaxxed had 4020 Omicron case and made up 70.53% of the population.
So the case rate ratio, 2 dosed to no dosed, was 4020/186 x 26.5/70.53 = 8.12 to 1.
This corresponds to an Immune system degradation of (1-8.12)/8.12 = -0.877 or -87.7%
So doubly vaxxed Germans were more than 8x likely to catch Omicron than their unvaxxed brothers. We now know that this figure correlated very closely with the Australian data for the 1st week in January (with a ratio of 10.72 to 1) and with the Canadian data for the last 2 weeks in December which had an immune degradation of 84%.
This was covered in the Daily Expose of January 2 - https://dailyexpose.uk/2022/01/02/german-gov-data-suggests-fully-vaccinated-developing-ade/. Then first thing on January3, the Robert Koch Institut discovered that they had 'made a mistake'!
Yes, there had been a Koch up,. They miraculously found 911 more unvaccinated Germans who had caught Omicron on the very next day after the Expose published figures that would have destroyed the credibility of Pfizer and Moderna against Omicron had they been permitted to stand. How incredible that a bureaucracy could respond so quickly! How unbelievable that and outfit capable of such an alacratous response could have made such an elementary error in the first place. Or indeed that the error should only have been in the unvaccinated number and that all the other numbers in their 14 page report were perfectly correct. Of course no explanation was given as to where these 911 unvaccinated Omicron sufferers had come from. Maybe there was an epidemic of the unvaccinated in the German antiterrorist office? The Expose covered this correction on January 9 - https://dailyexpose.uk/2022/01/09/life-insurance-data-proves-vaccinated-more-likely-to-die/
But once again the same pattern is seen. A government stats department produces figures proving that the vaccines have become anti vaccines and are seriously degrading the immune systems of their people and rather than having an enquiry to determine how their people can best be protected from these toxins, they just rig the figures. The Germans, being one of the more efficient governments in this world, rigged their figures more quickly and more decisively than most of their competitors in Covid cover ups.
I wrote to various branches of PHE and Sajid Javid on 2021July1 saying
Sir,
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/997418/Variants_of_Concern_VOC_Technical_Briefing_17.pdf
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/997414/Variants_of_Concern_VOC_Technical_Briefing_16.pdf
Here are the PHE data for Delta deaths in the week from June14-June21. Vax status on June 17 was...22% 1 jab and 63% 2 jabs and 15% 0 jabs (at least 21 days previously) - https://www.bbc.co.uk/news/health-55274833
0 Jabs 38-34 = 4 dead from 3.5m over 50s (15%)
1 Jabs 17-10 = 7 dead from 5.2m over 50s (22%)
2 Jabs 50-26 = 24 dead from 14.9m over 50s (63%)
0 Jabs are 4x63/15x24 = 0.70x more likely to die than 2 Jabs
0 Jabs are 4x22/15x7 = 0.83x more likely to die than 1 Jab
2 Jabs are 24x22/63x7 = 1.20x more likely to die than 1 Jab
So in the week from June14-21, the latest published PHE data, you were better off not being vaccinated. And 1 Jab was better than 2 Jabs.
These data are for death with COVID rather than deaths from COVID. There are 23.6m people over 50 in the UK. 1350 of these die every day of all causes. So during 7 days 9450 would die. This is a rate of 0.4 per 1000. Total cases were 976 (0Jabs), 3865 (1Jab), 3546 (2Jabs). So if we deduct those who would have died anyway we get.
0 Jabs 4 - 0.4 = 3.6 dead from 3.5m over 50s (15%)
1 Jabs 7 - 1.5 = 5.5 dead from 5.2m over 50s (22%)
2 Jabs 24 - 1.4 = 22.6 dead from 14.9m over 50s (63%)
0 Jabs are 3.6x63/15x22.6 = 0.67x more likely to die than 2 Jabs
0 Jabs are 3.6x22/15x5.5 = 0.96x more likely to die than 1 Jab
2 Jabs are 22.6x22/63x5.5 = 1.44x more likely to die than 1 Jab
So the best we have for the week from June14-21 from PHE data is that 1 Jab gives the same protection a 0 Jabs. And 2 Jabs make things worse.
24 delta deaths from 2 Jabs compared to 4 delta deaths from 0 Jabs is a disaster.
Regards...
Their response was to fail to publish Technical Bulletin18 on July2 and instead to publish it on July9 and change the frequency of publication to biweekly rather than weekly - an incredible thing to do to a weekly report. All the other countries whose data I have seen, publish weekly Covid reports, not biweekly Covid reports. And of course PHE figures never again showed that being unvaxxed gave a lower death rate than being doubly vaxxed.. There again is the Pfizergate cover up. What should have happened is an immediate investigation comparing the benefits of one dose to that of two doses and zero doses.
But every set of figures I have seen since then, and I have seen very many sets, from very many countries, shows clearly that 1 jab is better than 2. The reason for this I now know. 1 Jab does not give the spikes a large enough advantage over your immune system to start degrading it much. You need two jabs to really kick off the progressive degradation of the immune system.
If you have only had 1 jab there is no data I have seen showing that you will get VAIDS.
Another common feature to all the Covid stats cover ups I have seen is that the initial stats for each new variant are fairly accurate because the politicians have not yet decided what to do with them and the techies who produce the stats will produce the truth if they are not interfered with by politicians who lie for a living. Now the techies KNOW that their stats show vaccines to be dangerous. But they are smart enough not to tell that to the politicians. The Politicians are too stupid or too lazy or to incurious to discover for themselves that their own stats are destroying their vaccine pushing sales patter. So they carry on regardless until some media outfit (generally the expose) informs the world that their own stats prove that vaccines are killing people. Then rather than stopping that killing, they just rig the stats to cover up the deaths.
On 2021October10, the expose carried a piece which showed clearly that vaccine were causing a form of AIDS. The piece went viral and ended up being quoted on Alex Jones through the Reese report and by President Bolsonaro of Brazil. Here is the data which showed the progressive immune system destruction....
Age group | Week36 Decline |
Week37 Decline |
Week38 Decline |
Week39 Decline |
Week40 Position |
Average Weekly Decline |
Weeks before total immune system failure (100% degradation) |
18-29 | -2.5% | -1.9% | -4.0% | -4.3% | +40.5% | -3.2% | 44 weeks (140.5/3.2) |
30-39 | -6.0% | -7.0% | -10.5% | -11.4% | -3.3% | -8.7% | 12 weeks (96.7/8.7) |
40-49 | -5.2% | -5.3% | -8.1% | -6.9% | -46.6% | -6.4% | 9 weeks (53.4/6.4) |
50-59 | -4.0% | -2.4% | -3.9% | -5.7% | -40.1% | -4.0% | 15 weeks (59.9/4) |
60-69 | -4.2% | -2.9% | -4.2% | -2.1% | -40.9% | -3.35% | 18 weeks (59.1/3.35) |
70-79 | -4.1% | +0.7% | -3.9% | -3.6% | -34.4% | -2.7% | 25 weeks (65.6/2.7) |
80+ | -5.6% | -7.1% | -3.1% | -2.5% | -9.8% | -4.6% | 20 weeks (90.2/4.6) |
Then on October15, October 23 and October 27 the expose published 3 follow up pieces which confirmed the original article. Here is the last table of data from the UKHSA before it got cprrupted...
Here is the weekly decline in doubly vaccinated immune system performance compared to unvaxxed people. Vaccine efficacy is measured using Pfizer's vaccine effectiveness formula...
(Unvaxxed case rate - Vaxxed case rate)/the Larger of Unvaxxed or Vaxxed case rate - We are using the normalised absolute ratio of vaxxed to unvaxxed case numbers to determine vaccine efficiency just as Pfizer itself did in the Supplementary Appendix to their Phase III clinical trial results.
Age group | Week35 Vaccine Efficacy |
Week36 Decline |
Week37 Decline |
Week38 Decline |
Week39 Decline |
Week40 Decline |
Week41 Decline |
Week41 Vaccine Efficacy |
Average Weekly Decline |
Weeks from week41 (October11-17) before total immune system failure (100% degradation) |
18-29 | +53.2% | -2.5% | -1.9% | -4.0% | -4.3% | -7.0% | -8.6% | +24.9% | -4.7% | 27 weeks (124.9/4.7) |
30-39 | +31.6% | -6.0% | -7.0% | -10.5% | -11.4% | -10.5% | -7.7% | -21.5% | -8.85% | 9 weeks (78.5/8.85) |
40-49 | -21.1% | -5.2% | -5.3% | -8.1% | -6.9% | -5.6% | -3.2% | -55.4% | -5.7% | 8 weeks (44.6/5.7) |
50-59 | -24.1% | -4.0% | -2.4% | -3.9% | -5.7% | -5.7% | -5.0% | -50.8% | -4.45% | 12 weeks (49.2/4.45) |
60-69 | -27.5% | -4.2% | -2.9% | -4.2% | -2.1% | -5.8% | -4.0% | -50.7% | -3.9% | 13 weeks (49.3/3.9) |
70-79 | -23.5% | -4.1% | +0.7% | -3.9% | -3.6% | -9.6% | -6.3% | -50.3% | -4.5% | 12 weeks (49.7/4.5) |
80+ | +8.5% | -5.6% | -7.1% | -3.1% | -2.5% | -8.3% | -7.1% | -25.2% | -5.6% | 13 weeks (74.8/5.8) |
A Vaccine efficacy of +50% means that doubly vaxxed people are 50% more protected from Covid than unvaxxed people. It means that the delta case rate in the vaxxed is half the delta case rate in the unvaxxed.
A Vaccine efficacy of -50% means that unvaxxed people are 50% more protected from Covid than doubly vaxxed people. It means that the delta case rate in the vaxxed is double the delta case rate in the unvaxxed.
A Vaccine efficacy of 0% means that doubly vaccinated people are 0% more protected from Covid than unvaxxed people. It means that the delta case rate in the vaxxed equals the delta case rate in the unvaxxed. It means the vaccines have lost all their effectiveness.
Age group | Week35 Vax Efficacy |
Week36 Vax Efficacy |
Week37 Vax Efficacy |
Week38 Vax Efficacy |
Week39 Vax Efficacy |
Week40 Vax Efficacy |
Week41 Vax Efficacy |
18-29 | +53.2% | +50.7% | +48.8% | +44.8% | +40.5% | +33.5% | +24.9% |
30-39 | +31.6% | +25.6% | +18.6% | +8.1% | -3.3% | -13.8% | -21.5% |
40-49 | -21.1% | -26.3% | -31.6% | -39.7% | -46.6% | -52.2% | -55.4% |
50-59 | -24.1% | -28.1% | -30.5% | -34.4% | -40.1% | -45.8% | -50.8% |
60-69 | -27.5% | -31.7% | -34.6% | -38.8% | -40.9% | -46.7% | -50.7% |
70-79 | -23.5% | -27.6% | -26.9% | -30.8% | -34.4% | -44.0% | -50.3% |
80+ | +8.5% | +2.9% | -4.2% | -7.3% | -9.8% | -18.1% | -25.2% |
"Everybody over 30 will have lost 100% of their entire immune capability (certainly for Covid and most likely for viruses and certain cancers - following the evidence from Cole Diagnostics in Idaho and Dr Nathan Thompson and Dr Ralph Baric) within 13 weeks". - https://dailyexpose.uk/2021/10/27/official-government-reports-suggest-the-fully-vaccinated-will-develop-acquired-immunodeficiency-syndrome-by-christmas/
These were accurate figures from the UKHSA that clearly showed progressive week on week immune system degradation, just as the Canadian figures above showed for the last 10 weeks before Omicron hit Canada. This was the techies at the UKHSA telling us the truth. But after 4 hard hitting articles in the Expose showing that these vaccines cause a form of AIDS, the politicians stepped in...
On November2, the Daily Mail published an article revealing that...
1. UK statistics watchdog scolds PHE's replacement body for publishing 'misleading' figures which anti-vaxxers have seized as proof that Covid jabs don't work
2. Over the past few weeks, the agency's data shows infection rates are higher in fully-vaccinated adults compared to the unjabbed.
3. Anti-vaxx commentators and campaigners have seized the data as proof that Covid vaccines don't work.
The UK's Statistics Watchdog is The Office of Statistics Regulation (TOSR for short). Yes Offstats told the UKHSA that their Stats were off.
TOSR director general Ed Humpherson yesterday wrote to the UKHSA's boss Dr Jenny Harries on November1 thanking her for the changes she had made and is quoted in the Daily Mail as saying
'It remains the case that the surveillance report includes rates per 100,000 which can be used to argue that vaccines are not effective,'
'I know that this is not the intention of the surveillance report, but the potential for misuse remains.
There is the tacit admission by the Government that the purpose of their stats is not to enable the public to decide for themselves whether the vaccines are effective or not. No their stats should not even be able to support an argument that the vaccines are ineffective. Indeed any such construction of UKHSA statistics would be a misuse of government data according to the Director General. This is his candid admission that the use of all UKHSA data is exclusively to prove the vaccines are effective. And any government statistics agency which departs from that line shall be re-adjusted by TOSR. He is defining the UKHSA as a pro vaccine propaganda outfit, a sales arm of Pfizer inc. whose mandate is only to supply information for one side of the debate. No person in the UK can be expected to make an informed choice of whether to take Pfizer's experimental gene corrupting snake bite when it is presented to them by the government as an unquestionably effective Covid vaccination. - https://www.dailymail.co.uk/health/article-10155799/Stats-watchdog-scolds-PHE-replacement-data-misuse-supports-anti-vaxxers.html
So here was the UKHSA cover up ordered by the TSOR. Here was the UKHSA arm of Pfizergate.
Here is Table12 from the latest PHS Weekly Covid Statistical Reports - https://publichealthscotland.scot/publications/covid-19-statistical-report/covid-19-statistical-report-9-february-2022/
The red warning above appeared after the expose used PHS figures to prove that vaccines increase your chances of being infected with Covid, and they increase your chances of being hospitalised with Covid and they increase your chances of dying from Covid. - https://dailyexpose.uk/2021/12/09/distracted-by-christmas-party-data-shows-9-in-10-covid-deaths-vaccinated/
Had PHS cared about the life of their fellow Scots, they would have terminated vaccination pending a full public inquiry. But they do not care if Scots live or die so long as they live or die fully vaccinated. And yet even that term is a total fraud.
Nobody who is vaccinated with Pfizer or Moderna is fully vaccinated at all. If they were fully vaccinated, then they would not get infected with Covid
would they?
If they were fully vaccinated then they would not need a booster and another booster would they?
Fully vaccinated people are fully duped, fully conned and are on the way to having their genes fully corrupted and their immune systems fully compromised. The one thing they are not is fully vaccinated.
As regards Public Health Scotland. To paraquote Sir Winston, no longer are they in the business of public health and no longer do they represent Scotland. They are in the business of gene corrupting drug pushing through fraudulent statistics, and they represent the interests of American Pharmaceutical companies, not the interests of Scotland or her people.
The notes underneath Table12 above refer to Appendix6 of the report, which says:: Age standardised case, hospitalisation and mortality rates are used to allow comparisons of case, hospitalisation and mortality rates between populations that have different age distributions. The 2013 European Standard Population is used to standardise rates. For more information - see the ONS methods. Here is the full link - https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/deaths/methodologies/weeklycovid19agestandardisedmortalityratesbyvaccinationstatusenglandmethodology
Notice that it refers to Age Standardised Mortality Rates. Here is some of what it says:
Age-standardised mortality rates: Age-standardised mortality rates (ASMRs) are used to allow for comparisons to be made between populations that may contain different overall population sizes and proportions of people of different ages.
These are plainly age standardised MORTALITY rates. They are not age standardised Hospitalisation rates and they are not age standardised Case rates. There is absolutely no age standardisation that is needed for case rates or hospital rates. And even if there was, said rates would not been known in 2013 when the mortality rates were calculated, because there were no Covid cases in 2013 and there were no Covid hospitalisations in 2013.
To apply a 2013 European mortality rate to a 2019 Covid case rate is an all out fraud being committed by PHS and by the Canadian government in broad daylight. Even the UKHSA does not treat its taxpaying funders with such studied intellectual contempt.
Age standardised mortality rates are a compensation method designed to account for age discrepancies in mortality rates between the different statistical groups (such as groups with different vaccine statuses). They are merely a corruption when applied to statistical groups who are not dying. As mentioned above: One cannot apply a mortality compensator to a statistic that does not involve mortality. THAT IS FRAUD PURE AND SIMPLE.
One might as well compensate the case rates with how good people in the 5 year age bands are at singing Whitney Houston. It would be no less valid.
But if one does apply Euro 2013 Age Standardised Mortality Rates to case rates and hospitalisation rates then since the unvaxxed are slightly younger, than the vaxxed it makes the numbers look better for the vaccinated. Furthermore since neither PHS nor the UKHSA nor Canada provide data by vax status by age band (not withstanding FOI requests by Profs Fenton and Neil of QMC to do just that). They can do what they want with those numbers.
Here is an example of PHS using this fraud to persuade Scots to get vaccinated...
"In the past four weeks from 08 January 2022 to 04 February 2022, the age-standardised rate of hospital admissions per 100,000 was 2.9 to 3.8 times lower in individuals with their third dose or booster dose of vaccine compared to unvaccinated individuals or have received one or two doses of a COVID-19 vaccine". - PHS Covid19 Statistical Report Feb9
But the very fact that both Canada and PHS apply Euro 2013 Age Standardised Mortality Rates to non mortality statistics shows us all we need to know about what is going on here. It is wholesale fraud and it is worldwide. And that brings us back to the observations of Dr Coetzee that Omicron is mild in the unvaxxed (77% of South Africans in 2021November) and does not lead to hospitalisation or acute respiratory infection (in Southern Hemisphere Summer)., The reason that Euro politicians tried to not only silence her but to persuade her to say the opposite of what she had found in her medical practice, is that she was threatening the basis for further vaccinations. She was actually pronouncing deliverance from a pandemic, which is great for the health of Europe. But the politicians are not interested in that health. Vaccination is the end they seek, not good health. Dr Coetzee has exposed their true motivation.
PHS ceased publication of case rates hospitalisation rates and death rates by vaccine status on 2022February11, just as Pfizer terminated their 3 year vaccine trail after 6 months, by vaccinating the placebo group - https://www.glasgowtimes.co.uk/news/19931641.covid-data-will-not-published-concerns-misrepresented-anti-vaxxers/
Pfizer however did not blame their desertion of science on anti vaxxers.
UKHSA Note1 to Table13: Comparing case rates among vaccinated and unvaccinated populations should not be used to estimate vaccine effectiveness against COVID-19 infection. Vaccine effectiveness has been formally estimated from a number of different sources and is summarised on pages 4 to 15 in this report.
PHS Note1 to Table12: Data in this table should not be used as a measure of vaccine effectiveness due to unaccounted for biases and risk factors in different populations. For more information, please see the Interpretation of data and Vaccine effectiveness summary sections above.
On Page 13 of the Supplementary Appendix to Pfizer's seminal Phase III clinical trial of their BNT162b2 mRNA Covid19 Vaccine, Pfizer defined and calculated the effectiveness of their vaccine as the normalised case rate ratio between the vaxxed and the unvaxxed as follows...
VE against severe occurrence after dose 1 was 1-1/30 = 29/30 = 0.96666 or 96.7%
VE against severe occurrence after dose 1 and before dose 2 was 1-0/6 = 1 = 100%
VE against severe occurrence from <7 days after Dose 2 was 1-0/1 = 1 =
100%
VE against severe occurrence >=7 days after dose 2 was 1-1/23 = 22/23 =
0.9566 or 95.7%
Pfizer defined calculated and claimed Vaccine Efficacies of 96.7% for 1 dose and 95.7% for 2 doses using the very normalised case rate ratio that the UKHSA and PHS instruct readers NOT to use.
The numbers in the table 1, 0, 0, 1 for the vaccinated and 30, 6, 1, 23 for the unvaccinated, were actual case numbers not calculated case ratios. But they were also the respective case rates per 23k people because the numbers in each group were almost identical (23,040 vaxxed and 23,037 unvaxxed) as shown above under BNT162b2 and Placebo.
So PHS and the UKHSA are instructing their readers not to use the definition that all regulatory agencies relied upon in granting their emergency use Authorisations for the vaccines.
They are therefore instructing their readers not to use the correct definition of vaccine efficiency. That is a fraud. PHS go further in this fraud and represent that Pfizer's formula should not be used on their raw data "due to unaccounted for biases and risk factors in different populations".
It is true that any two populations unless randomly chosen, will have unaccounted for biases and risk factors influencing infection rates such as ethnicity, time vaccinated, age etc. But no government department has ever compensated for any of these confounding factors except for the factor of age using the irrelevant and inapplicable Euro 2013 Age Standardisation Mortality rates. Cases are not Deaths. One cannot successfully compensate for age in Covid case numbers using Euro 2013 all cause mortality figures.. All cause 2013 Euro death rates do not vary with age in the same manner as 2019 Covid infection rates. Nobody in Europe in 2013 even knew that there would be a pandemic in 2019 (although some Americans and some Chinese did possibly know it). PHS is just setting up the less statistically minded reader for a compensation fraud.
What these UKHSA and PHS warnings should say is that normalised case rate ratios are the correct way to calculate vaccine efficiencies and all the other figures in this report which do not equate to said correct calculation are inaccurate to the extent of their disparity there from.
Here are the Danish figures from their Statens Serum Institut: Nov21 to Dec25 - https://files.ssi.dk/covid19/omikron/statusrapport/rapport-omikronvarianten-31122021-ct18
Vaccination status (12+ year olds) | Other variants (No. of cases) | Other variants (%) | Omicron (No. of cases) | Omicron (%) |
Not vaccinated | 21,390 | 23.7 | 3,500 | 8.5 |
Received first dose | 2,813 | 3.1 | 731 | 1.8 |
Completed primary vaccination schedule | 56,532 | 62.5 | 29,781 | 72.0 |
Revaccinated | 9,704 | 10.7 | 7,330 | 17.7 |
Total | 90,439 | 100.0 | 41,342 | 100.0 |
So the ratio of double or triple vaxxed Omicron cases to unvaxxed cases is 37,111 to 3500 or 10.6 to 1.
Whereas the vaccination rates at the mid point of the 34 day period on December8 were 76.83 fully vaxxed, 0.14% singly vaxxed and 23.03% unvaxxed.
So the case rate ration between fully vaxxed and unvaxxed was 10.6x23.03/76.83 = 3.18x.
So the anti-vaccine efficiency against Omicron in Denmark was (1-3.18)/3.18 = -68.6%
The Expose published this on 2022January28. The response of the Statens Serum Institut in Denmark was to cease publication of their Omikron Status Report 9 days later on 2022February6, That is the Danish version of the Pfizergate cover up.
In Germany, in Australia, in Canada, in Denmark, in Scotland and in England we see the same pattern of events. A new variant comes out and the techies of the respective government stats departments do their job and get reasonably accurate statistics out for the new variant. Then the Expose publishes an analysis of these virgin statistics which have not yet been defiled by politicians. That analysis reveals the truth that doubly vaccinated people now have almost fully blown VAIDS, and that the vaccines therefore lead to more infections, more hospitalisations and more deaths than in the unvaccinated.
The politicians are then told about these articles. So all government stats departments must be avid readers of the Expose! PHE certainly wasted no time responding to my email. 24 hours after I rang them to speak to their chief statistics whizz about their figures. The response from their Public Accountability Office, was to ban me from communicating with them for 6 months. I paid no attention to their ban of course, because they are supposed to be the Public Accountability Office and I am a member of the public to whom they are supposed to be accountable!
So some bright spark then explains to the politicians that their statistics defeat their drug pushing narrative and destroy the scientific basis for their snake bite genetic corruption mandates (not perhaps in so many words). The politicians then respond by instructing their stats departments to commit medical fraud and cover up the death, disability, pain and suffering that these vaccines cause. That is the International Pfizergate cover up.
We know that government statistics people bend the truth to order, because Prof Graham Medley, the Head of Covid modelling for SAGE, admitted as much to Fraser Nelson of the Spectator Magazine
Yes and as Fraser succinctly declared, government stats departments indulge not in evidence based policy making but in policy based evidence making.
Pfizergate is the cover up of a multi-level, a 5 level, fraud. Their gene corrupting Trojans are a statistical fraud on top of a medical fraud on top of a hospital administration fraud on top of a regulatory body fraud on top of a genetic fraud
1. The vaccine is a fraud
mRNA Covid shot = Vaccine (against Wuhan Hu1 spike) + Antivaccine against absolutely every other pathogen known and unknown to man, which destroys the immune system at 6.57% of its remaining capability every week.
These vaccines are what software people call Trojans (after the Trojan horse given to Troy in Turkey by the Spartans from Greece) , They have the appearance of being a gift, having a genuine vaccinating effect from the initial short term spike protein production, which is valid against Wuhan Hu1 at perhaps 85% and against Delta at perhaps 70% and against Omicron at perhaps 20%. But they are combined with an anti vaccine, resulting from the medium and longer term spike protein production which destroys the immune system at a rate of around 4% of its remaining capability every week and which causes cardio vascular disasters and deaths especially in men and neurological degradation especially in women and cancers and recurring viral infections in both genders . They are in fact an equal opportunities gene corrupter and health destroyer in both men and women and children. The advantage that older people have here, is that their bodies work more slowly and so are less efficient spike production factories than those of younger people. This is why we see the worse VAIDS figures in the middle aged.
So here precisely in full and glorious technicolour and Dolby Surround Sound and IMAX 3D in the Expose is what all Government stats departments do NOT want you to see. this is what they are trying to cover up.
These Graphs take the initial 2nd dose efficiency of the Vaccines as being 90%, 70% and 20% against Alpha, Delta and Omicron respectively and then reduce immune system efficiency by 6.57% of its remaining capacity above minus 100% each week.
We deduce the 6.57% figure for the fractional weekly loss of the balance of immune capacity left to lose above minus 100%, from the table below of believable UKHSA data...
Age group | Week35 Vaccine Efficacy |
Week36 Decline |
Week37 Decline |
Week38 Decline |
Week39 Decline |
Week40 Decline |
Week41 Decline |
Week41 Vaccine Efficacy |
Average Weekly Decline |
Weeks from week41 (October11-17) before total immune system failure (100% degradation) |
18-29 | +53.2% | -2.5% | -1.9% | -4.0% | -4.3% | -7.0% | -8.6% | +24.9% | -4.7% | 27 weeks (124.9/4.7) |
30-39 | +31.6% | -6.0% | -7.0% | -10.5% | -11.4% | -10.5% | -7.7% | -21.5% | -8.85% | 9 weeks (78.5/8.85) |
40-49 | -21.1% | -5.2% | -5.3% | -8.1% | -6.9% | -5.6% | -3.2% | -55.4% | -5.7% | 8 weeks (44.6/5.7) |
50-59 | -24.1% | -4.0% | -2.4% | -3.9% | -5.7% | -5.7% | -5.0% | -50.8% | -4.45% | 12 weeks (49.2/4.45) |
60-69 | -27.5% | -4.2% | -2.9% | -4.2% | -2.1% | -5.8% | -4.0% | -50.7% | -3.9% | 13 weeks (49.3/3.9) |
70-79 | -23.5% | -4.1% | +0.7% | -3.9% | -3.6% | -9.6% | -6.3% | -50.3% | -4.5% | 12 weeks (49.7/4.5) |
80+ | +8.5% | -5.6% | -7.1% | -3.1% | -2.5% | -8.3% | -7.1% | -25.2% | -5.6% | 13 weeks (74.8/5.8) |
18+ | -2.9% | -4.5% | -3.7% | -5.4% | -5.2% | -7.5% | -6.0% | -32.7% | -5.4% |
We assumed a linear immune system degradation in the table above. But that is a very crude approximation. Having looked at a lot of Covid data, we can now make a far more accurate mathematical projection for the time it will take doubly vaccinated people to develop full blown VAIDS as follows.
The average Vaccine Efficiency in the entire table is (-2.9%-32.7%)/2 = -17.8% (82.2% left to lose) and the average weekly degradation rate is 5.4%. So the average weekly degradation rate at 0% vaccine efficacy (100% left to lose) would be higher at
5.4%x100/82.2 = 6.569%
Hence we take the weekly degradation as 6.57% in the graphs above..
Week1 = Week0 - 0.0657(Week0+100) = 0.9343Week0 - 6.57
Week(n+1) = Week(n) - 0.0657(Week(n)+100) = 0.94Week(n) - 6.57
These figures will be fairly accurate for 2 dose immune system degradation. If you take a 3rd dose you will do better for perhaps 6 weeks, and then degrade at a faster rate and end up doing worse after perhaps 12 weeks. The figures assume that spike production carries on unabated. We have seen some evidence that spike production may now have slowed down in the double vaxxed in the latest UKHSA figures. But they are so corrupt we cannot rely on them. Immune system degradation at 6 months after the 2nd jab as measured by the Omicron case rate ratio is -80% which is close to what was seen in Germany in the last week of 2021.
The graphs are asymptotic to -100% (decreasing exponentially) because we are losing 6.57% of an ever decreasing balance of immune capability.
The famous phrase from Virgil's Aeneid is Timeo Danaos et dona ferrentes
This literally means I fear the Greeks EVEN gifts carrying. From which the phrase Beware of Greeks bearing gifts is derived.
The writer would like to update that phrase to read: Beware of Politicians giving away free medicines.
What the mRNA vaccines should have been and still could be is....
A. Not made from the spike protein of Wuhan Hu1 but made from all the non spike proteins or Alpha, Delta and Omicron together (like the flu vaccines)
B .No substitution of Uracil with N1 Methylpseudouridine in vaccine mRNA
C. One dose of 10ug not 3 doses of 30ug or 100ug
But even that is too experimental for a large rollout. The only safe vaccine would be the Novavax type of the above, which carries the non spike proteins but not their mRNA - the writer suspects. Novavax itself is made from the Wuhan Hu1 spike protein and so is pointless against Omicron (if you'll pardon the pun). And Novavax is not safe because the Spike proteins are all pathogens. But a Novavax type intervention following ABC above would be the normal flu jab type intervention that would not have caused any significant number of deaths or heart attacks or neurodegenerative diseases and would have had a better effectiveness on Covid since it would not have degraded the immune system. But then this was never about healthcare was it. It was about genetic modification of humans and the appropriation of our immune systems by drug dealers.
2 The regulators are frauds: Regulators are being funded to licence lethal Pharmaceuticals and to mandate lethal Covid protocols
Here is the MHRA response to a FOI request...
21st June 2021 FOI 21/624
Dear
Thank you for your email.
We do receive funding from the Bill and Melinda Gates Foundation as well as other sources outside government such as WHO. This funding mainly supports work to strengthen regulatory systems in other countries.
The majority of our income comes from the pharmaceutical industry through fees.
The largest funder of the WHO is the Bill and Melinda Gates Foundation (directly and through GAVI, the Global Alliance for Vaccines and Immunization).
So here the Gates empire which founded the Global Vaccine Action Plan in 2010 and the Pharmaceutical Industry as a whole, are funding our UK Medicine Regulator. The MHRA does not get much money in Pharmaceutical fees from Ivermectin or Hydroxy Chloroquine. If it permitted the use of those medicines in its Covid protocols I dread to think what might happen to MHRA Christmas bonuses.
There is a pattern to all the levels of Pfizergate fraud. And that pattern is people in power putting their wealth above other peoples health.
3. Hospital administrations are frauds: Hospital administrations are being paid to falsify Covid stats and to adhere to lethal globally prescribed Covid protocols
At the beginning of the pandemic 25% of Covid cases came from poor hygiene in Hospitals. Hospitals and Care homes together were responsible for over half the deaths of the pandemic before vaccination. One would have thought that by now hospitals would have got their acts together as care homes have done, and that their figures would have gone down. But the financial temptation for those administrations which are more interested in financial remuneration than they are in moral integrity (and that is around 100% of all hospital administrations) is to identify every unaxxed hospital case, every unvaxxed ICU case and every unvaxxed patient at death's door and give them a false positive Covid test by increasing the PCR cycles.
This enables hospital administrations to manufacture unvaxxed Covid admission numbers and unvaxxed Covid deaths at will. And this indeed is where the lie that vaccines although unable to protect against infection do in fact protect against hospitalisation and death, actually comes from. The Oxford Vietnam study and the CDC Barnstable study showed that in July 2021 viral loads in the vaxxed were the same as those in the unvaxxed. Since then viral loads have been higher in the vaxxed. So they are more infectious, more likely to be hospitalised and more likely to die. Vaccines are supposed to reduce viral load not to increase it. Anything which increases viral load is an antivaccine not a vaccine.
The concept that Pfizer shots increase viral load whilst at the same time reducing hospitalisations and deaths is a medical impossibility. Having more enemy troops in your compound does not make you more likely to win the war. It makes you more likely to need help and more likely to lose it. But logic was the first casualty of this vaccine propaganda war.
All the trumpeted reductions in hospitalisations and deaths were manufactured by false positive or even by true positive Covid testing of unvaxxed patients in circumstances where vaxxed patients were not tested as frequently or with as many PCR cycles.
4. Medical staff who vaccinate have become frauds: Medical staff are being blackmailed through their practice licences to dispense lethal pharmaceuticals and misrepresent their safety and efficacy. They none of them are permitted to use their 10 years of medical training or their perhaps 20 years of clinical experience to judge for themselves in consultation with their patients, what the best treatment course would be. They have been turned into regulatory agency protocol enforcers by big Pharma remuneration.
The concept of a universal treatment protocol is a denial of the age old medical adage that there is no universal panacea for every patient for any one condition. We are all different and we therefore require different combinations of medications and/or surgery and/or dietary and/or other interventions to best treat our particular manifestation of a disease. Applying a Big Pharma dictated regulator mandated hospital admin enforced universal medical protocol, is the equivalent of replacing a scalpel with a Swiss penknife in coronary bypass operation. It is bound to fail. But during that failure a lot of money will be made by all concerned before the patient inevitably dies. If said patient can be PCR tested Covid positive before he dies, then even more money can be made by the Covid vultures of this world.
5. Politicians are frauds: Politicians have somehow all morphed into Pharmaceutical Sales Representatives. It is the most incredible thing to see politicians begging people to take a 3rd flu shot, whilst refusing to fund even one dose of so many life saving anti cancer drugs. How has this happened?
Well the fraud is Global and it involves Vaccines. And all Gobal Vaccination roads that I have gone down lead to one outfit. The Bill and Melinda Gates foundation
GVAP: 2010: The World Health Organization (WHO), UNICEF, the National Institute of Allergy and Infectious Diseases (NIAID) and the Bill & Melinda Gates Foundation have announced a collaboration to increase coordination across the international vaccine community and create a Global Vaccine Action Plan.
https://www.gatesfoundation.org/ideas/media-center/press-releases/2010/12/global-health-leaders-launch-decade-of-vaccines-collaboration.
The Leadership Council is comprised of:
Dr. Margaret Chan, Director General of WHO;
Dr. Anthony S. Fauci, Director of NIAID, part of the National Institutes of Health;
Mr. Anthony Lake, Executive Director for UNICEF;
Ms. Joy Phumaphi, Chair of the International Advisory Committee and Executive Secretary, African Leaders Malaria Alliance
Dr. Tachi Yamada, President of Global Health at the Bill & Melinda Gates Foundation
GAVI, formerly known as the “Global Alliance for Vaccines and Immunization”, provided the WHO with an additional $150 million in 2018. One of GAVI’s main donors is again the BMGF, with $1.5 billion in 2016, for example.”
“It can therefore be said that the BMGF and thus the Gates family and Warren Buffett are the main source of income for the WHO through direct and indirect channels, which raises questions about its independence from these sources of finance. In addition, the BMGF also provided funding for the establishment of the “Coalition for Epidemic Prevention Innovation”
(CEPI), which is concerned with the research and development of vaccines, amounting to around $100 million in 2017.”
“In addition, the Foundation regularly supports non-governmental organizations such as PATH, which are involved in the development of vaccination technologies, with millions of dollars in funding. The list of BMGF’s beneficiaries also includes the largest global pharmaceutical companies, such as Pfizer,
Novartis, GlaxoSmithKline and Sanofi Aventis. The comprehensive influence of the BMGF in the vaccination sector is therefore obvious.”
https://www.weblyf.com/2020/05/how-bill-gates-funds-the-who-and-other-organizations/
The Bill and Mellisa Gates Foundation set up GAVI in 1999 with a promise of $750 million in funding. So it was never going to be a bit part actor in the vaccine movie. - https://www.gavi.org/operating-model/gavis-partnership-model/bill-melinda-gates-foundation
And of course the WHO, which provided the Wuhan HU1 1273 amino acid Coivd19 spike protein to the vaccine companies, has the BMGF directly or indirectly as its largest funder.
The other thing we know about William Gates Junior is that he is an absolute master at the total monopolisation of an industry.
There is no doubt that Bill Gates turned his attention to the Vaccination Industry in 1999 through GAVI and increased his efforts in 2010 through the GVAP. He pretty much controls the WHO, The entire medical system in most countries in the world has been corrupted by money. Bill Gates is one of the richest men in the world. He succeeded in monopolising the Computer Industry overtaking IBM in a few short years in the 80s. How long would it take him to monopolise health care worldwide and become the sole antivirus provider for mankind? He has had 23 years in which to do it, counting from the founding and the funding of GAVI. He monopolised computers from a standing start. He took on health care from the head start of already being one of the richest men in the world.
In short he has the means. He has the form. He has the capability. He has the talent. He has the experience. He has shown that he has the motive. He has had enough time and he has massive control over the main healthcare regulators.
So it appears to the writer that the Spike Protein Vaccines (especially the mRNA ones) and their global enforcement, and the global takeover of healthcare that has come with them, are the piece de resistance of one William Gates Junior. They are his Rachmaninov's 2nd, his Beethoven's 5th, his Mozart's 40th, his Shakespeare's Act 2 Scene 2, his Strauss's Danube and his Queen's Rhapsody. But they will never be his Zeppelin's Stairway to Heaven. And the time is soon coming when they will be his McCartney's Yesterday.
So I say to all those caught up in this 5 level fraud: There is no wealth without health. Therefore there is no economic security in corrupted healthcare
And I say to all those in the mainstream media who are sitting on the fence. This is bigger than Watergate you would be Woodwards and burnt out Bernsteins. Now who's gonna step up to the scoop?
Appendix
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 11,100,000 | 671,339 | 35,848 | 7,120 |
Cases not yet protected | 400,000 | 40,590 | 2,823 | 719 |
Partially vaccinated | 1,800,000 | 46,083 | 2,919 | 681 |
Fully vaccinated | 20,200,000 | 43,268 | 1,813 | 520 |
12+
years (33.5m)
11.1 million people (12 and over) have achieved victory over vaccination pushers
22.4 million people have received at least one dose
22.0 million achieved partial vaccination status, of which 46,083 (0.21%) were diagnosed with COVID-19 while partially vaccinated
20.2 million achieved full vaccination status, of which 43,266 (0.21%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 10,900,000 | 678,410 | 36,579 | 7,264 |
Cases not yet protected | 400,000 | 41,278 | 2,859 | 730 |
Partially vaccinated | 1,700,000 | 47,230 | 2,968 | 691 |
Fully vaccinated | 20,500,000 | 48,555 | 2,035 | 608 |
12+
years (33.5m)
10.9 million people (12 and over) have achieved victory over vaccination pushers
22.6 million people have received at least one dose
22.2 million achieved partial vaccination status, of which 47,230 (0.21%) were diagnosed with COVID-19 while partially vaccinated
20.5 million achieved full vaccination status, of which 48,555 (0.24%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
Unvaccinated | 10,800,000 | 683,875 | 37,318 | 7,381 |
Cases not yet protected | 300,000 | 41,737 | 2,905 | 737 |
Partially vaccinated | 1,600,000 | 48,216 | 3,039 | 700 |
Fully vaccinated | 20,800,00 | 53,330 | 2,265 | 676 |
12+
years (33.5m)
10.8 million people (12 and over) have achieved victory over vaccination pushers
22.7 million people have received at least one dose as of October 16, 2021.
22.4 million achieved partial vaccination status, of which 48,216 (0.22%) were diagnosed with COVID-19 while partially vaccinated
20.8 million achieved full vaccination status, of which 53,330 (0.26%) were diagnosed with COVID-19 while fully vaccinated
Status |
Pop |
Cases |
Hospitalisations |
Deaths |
Unvaccinated |
10,600,000 |
688,473 |
37,837 |
7,482 |
Cases not yet protected |
300,000 |
42,054 |
2,923 |
738 |
Partially vaccinated |
1,600,00 |
49,028 |
3,081 |
707 |
Fully vaccinated |
21,000,000 |
57,684 |
2,482 |
733 |
12+
years (33.5m)
10.6 million people (12 and over) have achieved victory over vaccination pushers
22.9 million people have received at least one dose
22.6 million achieved partial vaccination status, of which 49,028 (0.22%) were diagnosed with COVID-19 while partially vaccinated
21.0 million achieved full vaccination status, of which 57,684 (0.27%) were diagnosed with COVID-19 while fully vaccinated
October 30 (got pdf) - https://web.archive.org/web/20211120122253if_/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 10,500,000 | 691,361 | 37,742 | 7,540 |
Cases not yet protected | 300,000 | 42,321 | 2,883 | 741 |
Partially vaccinated | 1,400,000 | 49,670 | 3,015 | 710 |
Fully vaccinated | 21,300,000 | 61,825 | 2,610 | 776 |
12+
years (33.5m)
10.5 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.0 million people have received at least one dose
22.7 million achieved partial vaccination status, of which 49,670 (0.22%) were diagnosed with COVID-19 while partially vaccinated
21.3 million achieved full vaccination status, of which 61,825 (0.29%) were diagnosed with COVID-19while fully vaccinated
Nov6 - https://web.archive.org/web/20211128152117/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
(incorrectly labelled as Nov13)
Nov6 - https://web.archive.org/web/20211128000628/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
(Nov6 pop Nov13 Cases)
Status |
Pop |
Cases |
Hospitalisations |
Deaths |
Unvaccinated |
10,500,00 |
695,396 |
38,751 |
7,651 |
Cases not yet protected |
100,000 |
42,539 |
2,957 |
749 |
Partially vaccinated |
1,400,000 |
50,261 |
3,165 |
717 |
Fully vaccinated |
21,500,000 |
66,709 |
2,900 |
837 |
12+
years (33.5m)
10.5 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.0 million people have received at least one dose
22.9 million achieved partial vaccination status, of which 50,261 (0.22%) were diagnosed with COVID-19 while partially vaccinated
21.5 million achieved full vaccination status, of which 66,709 (0.31%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalizations | Deaths |
---|---|---|---|---|
Unvaccinated | 10,400,000 | 699,046 | 39,245 | 7,715 |
Cases not yet protected | 100,000 | 42,723 | 2,970 | 749 |
Partially vaccinated | 1,200,000 | 50,789 | 3,210 | 722 |
Fully vaccinated | 21,800,000 | 71,822 | 3,102 | 881 |
12+
years (33.5m)
10.4 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.1 million people have received at least one dose
23.0 million achieved partial vaccination status, of which 50,789 (0.22%) were diagnosed with COVID-19 while partially vaccinated
21.8 million achieved full vaccination status, of which 71,822 (0.33%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 10,300,000 | 702,434 | 39,637 | 7,790 |
Cases not yet protected | 200,000 | 42,876 | 2,977 | 751 |
Partially vaccinated | 1,100,000 | 51,277 | 3,230 | 724 |
Fully vaccinated | 21,900,000 | 76,925 | 3,310 | 933 |
12+
years (33.5m)
10.3 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.2 million people have received at least one dose
23.0 million achieved partial vaccination status, of which 51,277 (0.22%) were diagnosed with COVID-19 while partially vaccinated
21.9 million achieved full vaccination status, of which 76,925 (0.35%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
Unvaccinated | 10,200,000 | 705,725 | 39,967 | 7,861 |
Cases not yet protected | 200,000 | 43,022 | 2,988 | 752 |
Partially vaccinated | 1,000,000 | 51,728 | 3,258 | 731 |
Fully vaccinated | 22,100,000 | 82,513 | 3,514 | 981 |
12+
years (33.5m)
10.2 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.3 million people have received at least one dose
23.1 million achieved partial vaccination status, of which 51,728 (0.22%) were diagnosed with COVID-19 while partially vaccinated
22.1 million achieved full vaccination status, of which 82,513 (0.37%) were diagnosed with COVID-19 while fully vaccinated
Dec 4 - https://web.archive.org/web/20211223170506/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
https://web.archive.org/web/20211223231903/https://health-infobase.canada.ca/covid-19/epidemiological-summary-covid-19-cases.html
Status | Pop | Cases | Hospitalisations | Deaths |
Unvaccinated | 9,900,000 | 709,123 | 40,287 | 7,917 |
Cases not yet protected | 400,000 | 43,114 | 3,000 | 753 |
Partially vaccinated | 1,000,000 | 52,116 | 3,277 | 734 |
Fully vaccinated | 22,200,000 | 88,742 | 3,705 | 1,017 |
12+
years (33.5m)
9.9 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
23.6 million people have received at least one dose
23.2 million achieved partial vaccination status, of which 52,116 (0.23%) were diagnosed with COVID-19 while partially vaccinated
22.2 million achieved full vaccination status, of which 88,742 (0.40%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
Unvaccinated | 9,400,000 | 727,925 | 40,788 | 8,013 |
Cases not yet protected | 500,000 | 43,471 | 3,062 | 759 |
Partially vaccinated | 1,200,000 | 53,171 | 3,374 | 744 |
Fully vaccinated | 22,400,000 | 122,843 | 4,099 | 1,077 |
12+
years (33.5m)
9.4 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
24.1 million people have received at least one dose
23.6 million achieved partial vaccination status, of which 53,171 (0.23%) were diagnosed with COVID-19 while partially vaccinated
22.4 million achieved full vaccination status, of which 122,843 (0.55%) were diagnosed with COVID-19 while fully vaccinated
Status |
Pop |
Cases |
Hospitalisations |
Deaths |
Unvaccinated |
9,300,000 |
728,415 |
41,089 |
8,076 |
Cases not yet protected |
300,000 |
43,754 |
3,077 |
761 |
Partially vaccinated |
1,400,000 |
54,772 |
3,402 |
748 |
Fully vaccinated |
22,500,000 |
219,445 |
4,569 |
1,131 |
12+
years (33.5m)
9.3 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
24.2 million people have received at least one dose
23.9 million achieved partial vaccination status, of which 54,772 (0.23%) were diagnosed with COVID-19 while partially vaccinated
22.5 million achieved full vaccination status, of which 219,445 (0.98%) were diagnosed with COVID-19 while fully vaccinated
Jan1 Canada (from Jan24 report) https://web.archive.org/web/20220124194636/https://health-infobase.canada.ca/src/data/covidLive/Epidemiological-summary-of-COVID-19-cases-in-Canada-Canada.ca.pdf
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 9,200,000 | 741,789 | 41,561 | 8,149 |
Cases not yet protected | 200,000 | 44,037 | 3,092 | 762 |
Partially vaccinated | 1,600,000 | 56,831 | 3,453 | 754 |
Fully vaccinated | 22,500,000 | 354,940 | 5,657 | 1,253 |
12+
years (33.5m)
9.2 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
24.3 million people have received at least one dose
24.1 million achieved partial vaccination status, of which 56,831 (0.24%) were diagnosed with COVID-19 while partially vaccinated
22.5 million achieved full vaccination status, of which 354,940 (1.57%) were diagnosed with COVID-19while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 9,100,000 | 758,702 | 42,412 | 8,285 |
Cases not yet protected | 200,000 | 44,274 | 3,103 | 765 |
Partially vaccinated | 1,800,000 | 59,073 | 3,554 | 766 |
Fully vaccinated | 22,600,000 | 479,143 | 7,592 | 1,565 |
12+
years (33.5m)
9.1 million people (12 and over) have achieved victory over gene corrupting vaccination pushers
24.4 million people have received at least one dose of the COVID-19
24.2 million achieved partial vaccination status, of which 59,073 (0.24%) were diagnosed with COVID-19 while partially vaccinated
22.6 million achieved full vaccination status, of which 479,143 (2.12%) were diagnosed with COVID-19 while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 11,800,000 | 771,095 | 43,540 | 8,479 |
Cases not yet protected | 300,000 | 44,494 | 3,118 | 770 |
Partially vaccinated | 1,600,000 | 61,209 | 3,717 | 788 |
Fully vaccinated | 22,600,000 | 581,635 | 10,387 | 2,032 |
5+
years (36.4m)
11.8 million people (5 and over) have achieved victory over gene corrupting vaccination pushers
24.6 million people have received at least one dose
24.3 million achieved partial vaccination status, of which 61,209 (0.25%) were diagnosed with COVID-19 while partially vaccinated
22.6 million achieved full vaccination status, of which 581,635 (2.57%) were diagnosed with COVID-19while fully vaccinated
Status | Pop | Cases | Hospitalisations | Deaths |
---|---|---|---|---|
Unvaccinated | 11,700,000 | 892,033 | 44,907 | 8,693 |
Cases not yet protected | 300,000 | 50,695 | 3,154 | 775 |
Partially vaccinated | 1,700,000 | 79,683 | 3,925 | 808 |
Fully vaccinated | 22,700,000 | 648,271 | 13,043 | 2,490 |
5+ years (36.4m)
11.7 million people (5 and over) have achieved victory over gene corrupting vaccination pushers
24.7 million people have received at least one dose
24.4 million achieved partial vaccination status, of which 79,683 (0.33%) were diagnosed with COVID-19 while partially vaccinated
22.7 million achieved full vaccination status, of which 648,271 (2.85%) were diagnosed with COVID-19 while fully vaccinated
_________________________
These days we can communicate by video with anyone on the planet instantly for free.
We can access and read all the knowledge of mankind from every library on the globe (which has gone online) instantly in colour on our computer screens.
We have the capability to travel to any city on the earth within 24 hours.
We can translate instantly from almost every language under the sun into our own tongue thanks to Google translate and their competitors.
We have the technology to record transmit and receive a direct news feed from every newsworthy event on the planet in real time.
We can buy and sell products to and from every nation on earth and have them delivered to our door by air within days and by land or sea within weeks.
We can see almost every product offered for sale worldwide just by visiting a handful of websites on the internet.
But what does this all mean?
It means the entire world has become one village.
But what does that mean?
It means the race is on to become the Mayor of that village, the Burgermeister of the whole world.
But the candidates for this position will not be culinary competitors to Burger King. They will be political competitors to democracy and ultimately to God himself. They will have to overthrow national democracy by stealth to achieve their goal and they will certainly overthrow religion in their lust to be worshipped as Gods by mankind, whom they seek to own outright.
The reason we should destroy all nuclear weapons now is that there will always be some idiot who is power crazy enough to use one.
The reason we must keep nation states and resist globalism is that there will always be too many applicants for the position of Herr Weltmeister, or for Madame le Maire du Monde, .
And these applicants will be the most cold hearted egotistical; megalomanic, dynoholic, deceptive, slimy, psychopaths in the history of politics..
So who are they? How should we fight them? And what will be their next move?
Well WW1 resulted in the formation of the League of Nations. Mankind's first attempt at a global government (actually his second if you include Nimrod and the tower of Babel).
WW2 resulted in the formation of the United Nations. Mankind's second and slightly more successful attempt at a global government. It managed to take over most of global healthcare for example.
So WW3 would be the time honoured route to this goal. Now the two strongest barriers preventing the 3rd incarnation of a global government, are the nationalism of Russia and the nationalism of mainstream USA and to a lesser extent the nationalism of the UK etc.
So what is needed here is to get Russia into a war with the US (which will also involve the UK) and take them both out by that means. Of course such a war might kill hundreds of millions of people given the present generation of weapons of mass destruction. But that is not an issue to the candidates in this race as we have already seen during the pandemic.
Indeed the pandemic and the government responses thereto have been the heats before the final race for the Mayor of Worldopolis.
So how do they persuade the Russians and the Americans to go to war with each other? Because without that war they cannot achieve their goal. The Covid-19 route was ruined by Omicron. Even Bill Gates recently acknowledged that
“Sadly, the virus itself – particularly the variant called Omicron – is a type of vaccine. That is, it creates both B-cell and T-cell immunity, and it’s done a better job of getting out to the world population than we have with vaccines" - https://www.rt.com/news/549937-bill-gates-omicron-vaccines/
Not only that but the vaccines do not work against Omicron according to the CEO of Pfizer Albert Bourla who in an interview with Yahoo Finance said that 2 doses of the vaccine have “very limited protection, if any” against the Omicron variant. That sent all the fact chuckers into total denial mode!
So here is the plan. Make the US military look so weak that it cannot even win a fight against the woke left. Make it look so impotent that it cannot defend even itself even against a vaccine mandate. Make it look so incompetent, so yellow bellied, so easily frightened and disoriented in Afghanistan, that it leaves thousands of its own citizens behind to be butchered by the Taliban after having evacuated its crack troops who forgot to take 89 billion dollars with of military hardware with them. Make it look like the door to the Ukraine is wide open and the restoration of the past imperial glory of Mother Russia is within her grasp. Entice Uncle Vladimir to enter into the quagmire of war.
He has a military that is superior to the rest of Europe. He has hypersonic weapons that can sink any battleship, including the two multibillion pound leaking missile targets that the UK navy just purchased. Surely victory for Russia is inevitable right? Wrong. No military general should ever ignore Ecclesiastes 9:11 which says
11 The swift do not have the race, nor the mighty ones the battle...time and unforeseen occurrence befall them all. (Ecclesiastes 9)
Here is what will happen (the writer would suggest from his understanding or misunderstanding of the Russian bear of Daniel7). Putin will not be able to resist invading Ukraine, because he is a chess player, and his opponent has already beaten himself. He has left his top military gear behind in Afghanistan to be analysed by the Kremlin for vulnerabilities and for capabilities. He has replaced battle hardened generals with anti American sexual activists. He has removed all traces of toxic masculinity from the US military and replaced them with platoon after platoon of personnel trained not to offend anybody. I don't know about you but I find it quite offensive to have a loaded gun pointed at me. And I find it even more offensive to be shot at. So quite how the US military will attack an opposing force without offending them, I cannot imagine.
So there will never be a better or a bigger or a more certain opportunity for Russia to take Ukraine and any other parts of Europe it feels like conquering - right? Wrong. It is a trap. It s TOO EASY. The destruction of the US military capability has been TOO FAST. It is not real. It is a faint by the globalists. Here is what will happen Vlad...
You will take the bait. You will invade. Things will start to go nuclear. Then Jesus will overturn the tables of the vote changers/counters in the temple of US Democracy just as surely as he overturned the tables of the money changers/counters in the temple of Zerubbabel rebuilt by Herod. Trump will be rightfully re-installed as President, having won the election by a considerable margin over basement Biden. And you will end up in a nuclear war with Trump which absolutely nobody will win. Nobody at all, that is, except for the globalists and their agents, the Chinese, who will act as subcontractors for absolutely anybody who will pay them. They do not care whether they are paid for manufacturing, for virology or for global politics. And they rather like the idea of Russia and America taking each other out. For then who will be the only remaining military superpower - glasshopper?
Sure you will expand mother Russia. But which would you prefer. To rule over a gazillion square miles of fertile land and 150 million healthy people who can stand you? Or to rule over 1½ gazzillion squares miles of infertile land and 300 million unhealthy and dying people who cannot stand you?
It will be a victory that makes Pyrrhus look like Montgomery. And here is why.
WAR FROM TODAY ONWARDS IS OBSOLETE
The offensive weapons are just too powerful to make it a worthwhile proposition. All wars from now onwards are a form of international suicide. There will be no winners .There will be big losers and there will be bigger losers. No winners amongst those nations taking part that is. But the globalists are not national governments. They do not take part directly. They manipulate. They deceive. They entice. Wars are generally caused by pride, ambition and greed, characteristics which national politicians are not short of. The globalists know how to use those desires to divide us, nation against nation, race against race, vaccine status against vaccine status, left against right, man against woman against ?, heterosexual against non heterosexual .They did it in WW1. They did it in WW2. The will do it in WW3.
These globalists do not represent the people of any nation. They do not even represent the people of this world. They represent themselves and only themselves.
That is what the Canadian Truckers have shown us. God bless them. They stood their ground and forced Justin Trudeau to show us whom he represents. Here is what the truckers achieved
1. 6 out of the 13 Canadian provinces were liberated from vaccine mandates due to their selfless sacrifice.
2. CNN were exposed as Globalist propaganda pedlars labelling a peaceful protest for basic human rights as an nationwide insurrection driven by madness, a threat to democracy, a sedition. Just as the democrats did with the largely peaceful FBI facilitated vote fraud sit in protest on January6.
3. CNN even claimed that the Russians could be behind the Truckers - having learned nothing from their false accusations in that regard against Trump.
4. Gofundme when asked by the police to withhold payment to the Truckers, actually conspired to commit theft of their customers money and give it not to the Truckers to whom it was donated, but to charities whom Gofundme chose! So the Truckers then approached a Christian funding site (GiveSendGo) who, although asked by the Canadian Police and ordered by a Canadian judge to withhold payment, refused point blank declaring that they were not bound by Canadian law.
5. Trudeau then froze the bank accounts of the Truckers and arrested them. But there is no basis in Canadian law to do that. So he declared martial law first. Then according to Joe Wilmington of the Toronto Sun
“The Trudeau government had already obscenely used blunt force by deputizing Canada’s banks to freeze the accounts of protesters and threatening to cancel their licenses, insurance and even take away their pets and children,”
So there it is. The globalists believe that they own your money, your pets, your children, your right to work, your security. They do not own any of those things of course. They are thieves. But the Truckers have shown us who we are dealing with. And all of this over vaccine mandates against Omicron which is no more dangerous than regular flu? Why oh why are they so important to the globalists? Well I keep telling people and they do not believe me.
The way for the globalists to get total control over you is through your genes. If they can successfully genetically modify you, then they own you - and that plainly is what they want. THEY WANT TO OWN YOU AND YOURS.
If they own you then they do own your money, your licenses, your insurance, your pets and your children of course.
And here is where the writer will attempt to introduce the reader to the most powerful weapon in the universe. It is more powerful that any bomb. It is more powerful than any law. And it is more powerful than any pathogen. It is the ultimate vaccination and it is the means by which the globalists will be defeated. You know it well. But you do not know it well enough. None of us do. It is called love. Love of freedom, love of fellowman, love of justice, and love of God/Creator/Nature. It is the invisible unconquerable power of the human heart!
It is a weapon which the globalists have no defence against and do not understand. It does not fit into any of their simulations. It is a currency in which they themselves are almost bankrupt.
The reason that there were money changers in the temple was that one could not buy sacrificial animals with regular money. One had to use the Shekel of the holy place. Only that particular currency was valid in the temple of Herod. This points forward to the new digital social credit score linked smart currency without which one will not be able to buy or sell anything in the temple of the great reset, the greater rebuilt temple of Herod. Build back better.
So there is no need to physically attack or attempt to overthrow these globalists by force (however tempting that may seem). Even that desire (righteous as it may be) is a trap. We learned that from January6 and from Jesus Christ. Just follow the example of the Truckers and those who cared for them. Peaceful protest and love for those fighting peacefully and standing their ground are the weapons to use. Because there is no future in war and no future in control freakery. They are both morally unsustainable which means they will cease.
However knowing what type of people the globalists really are and how draconian and dehumanising their goals, we must not cooperate with them in any way, or we become accessories to the modern day slave traders, which is quite ironic given the condemnation that these hypocrites heap onto those who traded or owned slaves 300 years ago.
1. General Strike in the 7 Provinces that Still have Vaccine Mandates
2. Exodus: Leave the 7 Provinces with Vaccine Mandates and Stay in the 6 Provinces with No Mandates
3. Do not call off the Exodus or the Strike until all Truckers and all other Political Prisoners are released AND All money is returned to them, all pets are returned to them, all children are returned to them, all insurances are returned to them, all licences are returned to them, the state of emergency and martial law are lifted and all charges against them are dropped.
4. The Canadian Government makes a constitutional amendment not to use emergency measures or martial law to persecute or punish its own citizens for human rights protests
5. The Canadian Government passes a law guaranteeing bodily autonomy for every medical intervention now and in the future for every Canadian citizen or resident or tourist or illegal immigrant, natural or genetically modified.
6. Declare the day this agreement is made a Canadian National Holiday - Truckers Day!
7. Every single one of the arrested Truckers is to be given full unfettered and immediate access to any and all data on or related to vaccine safety and/or on or related to vaccine effectiveness including all hospital records all funeral records all life insurance records all government records all intelligence agency records all pharmaceutical company records all care home records from 2019January1 onwards for 25 years by court injunction with penal notice for failing to comply involving fines and imprisonment (lives depend upon the accuracy and immediacy of this data)
You get one shot at this and only one. You must get it completely right first time. Do NOT call for the removal of Trudeau. Do not interfere with politics. Fight for rights not against politicians.
____________________________________________
On February 23 the Daily Mail ran an article showing that Moderna has patented the 19 base letter (nucleotide) sequence which codes for the Furin Cleavage site in Covid-19.
They cited a Paper by Scientists in India, Switzerland, Italy and the US (cautiously entitled: MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site) in which they calculated that the chances of a 19 nucleotide sequence patented by Moderna randomly appearing in Covid-19 in circumstances where it does not appear anywhere else in nature are 1 in 3 trillion. But they failed to make the obvious deduction there from. Had they made said obvious deduction I fear that might have been the last scientific deduction they ever got published!
They decided to investigate the RNA sequence for the Furin cleavage site in the Covid-19 Spike Protein to see if it occurred anywhere else in nature. .
Fortunately the NCBI/NIH have produced the wonderful BLAST database which catalogues every gene sequence in nature known to man and every synthetic patented gene sequence known to the patent office.
The researchers chose the Furin Cleavage sequence because it is the only continuous gene letter sequence (nucleotide sequence) in Covid-19 with more than 3 nucleotides, that differs from the respective letters in its closest natural relative the Bat Coronavirus RaTG13 (all other differences are 3 letters or less long). So it was by far the best candidate for determining whether or not Covid-19 was man made.
The reader might consider it more likely that a Furin Cleavage Site would appear in the Sun than in the Daily Mail. But this cleavage refers to the separation of spike from virus rather than pillow from pillow.
Furthermore the Furin Cleavage Site is key to the pathogenicity of Covid-19. So if there was to be some man made gain of function included in the virus, this is where one might expect to find it.
The Amino Acid sequence of the Furin Cleavage Site is PRRA (Proline Arginine Arginine Alanine). Each Amino Acid is coded for by a Codon, consisting of 3 nucleotides (genetic sequence letters). So all the differences in the genetic code between Covid-19 and RaTG13 are at most one Codon long, one amino acid long, other than the Furin Cleavage Sequence, which is...
CCT CGG CGG GCA
The complimentary sequence (the opposing DNA strand of the double helix is (GGAGCCGCCCGT) because C binds with G and A binds with T
The reverse compliment (the same thing written backwards) is therefore TGCCCGCCGAGG
The researchers did a BLAST (Basic Local Alignment Search Tool) alignment search (which means they search for the gene sequence, the reverse gene sequence, the complimentary gene sequence and the reverse complimentary gene sequence) through every gene sequence in nature known to man for CTCCTCGGCGGGCACGTAG which is the 19 nucleotide sequence containing the Furin Cleavage Sequence, which also appears in Covid-19, and which is found actually in the reverse compliment form CTACGTGCCCGCCGAGGAG patented by Moderna.
Their search results can be found here.
Table 1 shows that it does exist in the 5 US patents cited below...
US9149506B2: Modified polynucleotides encoding septin-4 - https://patents.google.com/patent/US9149506B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618953P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-05-22 Publication of US20140141067A1
2015-10-06 Publication of US9149506B2
2015-10-06 Application granted
2020-01-10 First worldwide family litigation filed
US9216205B2: Modified polynucleotides encoding granulysin - https://patents.google.com/patent/US9216205B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618873P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-04-24 Publication of US20140113960A1
2015-12-22 Publication of US9216205B2
2015-12-22 Application granted
US9255129B2: Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 - https://patents.google.com/patent/US9255129B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-05-22 Publication of US20140141068A1
2016-02-09 Application granted
2016-02-09 Publication of US9255129B2
US9301993B2: Modified polynucleotides encoding apoptosis inducing factor 1 - https://patents.google.com/patent/US9301993B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618957P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-04-17 Publication of US20140107189A1
2016-04-05 Application granted
2016-04-05 Publication of US9301993B2
2020-01-10 First worldwide family litigation filed
US9587003B2: Modified polynucleotides for the production of oncology-related proteins and peptides
- https://patents.google.com/patent/US9587003B2/en
Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2016-02-04 Application filed by ModernaTx Inc
2016-06-02 Publication of US20160152678A1
2017-03-07 Publication of US9587003B2
2017-03-07 Application granted
So Moderna first applied for a patent for the 19 nucleotide sequence in 2013 on December 16. Perhaps December25 would have been more appropriate since it was destined to become the Crown of Thorns of Mathew27, Mark15 and John19
Table2: Shows that the sequence occurs in Covid-19 from nucleotide 23601 to 23619.
Table3: Shows that this gene sequence does not exist in nature (but 14 nucleotide parts of it do).
I decided to check their work. Yes. I fact checked them (I will send an invoice to the globalists). This turned out to be a bit of an epic journey. The Google patent page for US9587003B2 does not contain the gene sequence. The pdf of the patent does not contain the gene sequence and is not searchable from pages 101-304. But it does have a link to a lengthy 'Sequence Listing" section which link one cannot copy. So I manually transcribed it in my fair hand - http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2
From that page you can enter the Sequence ID quoted in the paper as 11652 and get to https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 which has the following at Nucleotides 2751-2733 reading backwards...
gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760
CTACGTGCCCGCCGAGGAG patented by Moderna is the reverse compliment of CTCCTCGGCGGGCACGTAG, the 19 nucleotide sequence which appears in Covid-19 DNA from nucleotide 23601-23619 (which would therefore be covered by their patent).
Likewise you can search for the sequence in US9149506B2 by going to https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652, whereupon you will find the same thing again
gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760
I then searched the gene sequence of Wuhan Hu1 (alpha) at https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 and found
23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat from https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Which has the 19 nucleotide sequence CTCCTCGGCGGGCACGTAG from 23601-23619 as described in table 3.
I then ran my own non aligned blast search of all patented gene sequences for the reverse compliment directly (or perhaps for a back handed compliment) and got the same results as the researchers
And the same for the other 3 US patents.
So I can confirm, and the reader can confirm using the links above, that Moderna did apply for a Patent not only on the reverse compliment of the 12 nucleotide Furin Cleavage Site in Covid-19 but actually on the 19 nucleotide sequence containing it as described above. Furthermore they did not merely apply for a patent on 2016 February 4 with US9587003B2: as reported in the Daily Mail. They actually applied on 2013 December 16 for 4 patents with US9149506B2, US9216205B2, US9255129B2, US9301993B2:as well.
So Moderna had developed the 19 nucleotide gene sequence containing the Furin Cleavage Site which gives Covid19 its infectivity to humans by patented gain of function research as early as 2013, 6 years before the Wuhan outbreak took place. Not 3 as reported in the Mail and virally elsewhere. But the bat coronavirus RaTG13 from which Covid19 was derived was also discovered in 2013. Well, what a coincidence!
So now we look at the chances of this occurring naturally. The paper calculates the probability of this particular 19 nucleotide sequence occurring randomly in a 30,000 nucleotide virus as
(30,000-18) x (1/4)19 = 1.09 x 10-7
Which is correct because there are 30,000-18 places to start the sequence given that it needs a further 18 more letters to complete it. But there are actually 29,904 nucleotides in Wuhan HU1 (alpha). So a more accurate calculation would be
(29,904-18) x (1/4)19 = 1.087 x 10-7
Then they calculate the chances that the 19 nucleotide sequence occurs in the patented library of 24,712 sequences with a mean length of 3300 nucleotides. But that calculation is irrelevant because the sequence did not randomly appear in 5 Moderna Patent applications. The sequence was known to code for a Furin Cleavage Site, which is known to provide gain of function to Coronaviruses. It was put there deliberately and patented due to its infecting power in humans, which we shall see, later in the article, results from the normal viral Arginine (R) codon AGA (used in 45% of viral Arginine codons) being replaced by the human Arginine codon CGG (used in 0% of viral Arginine codons) in the furin cleavage site.
All we are tying to work out here is what the chances are of a 19 nucleotide sequence patented by Moderna turning up in Covid-19 through natural causes, the natural mutations of Bat Coronavirus RaTG13 or some other virus.
The nucleotides form Codons which are triplets. So there are 64 possible triplets of the 4 DNA nucleotides ACGT (4x4x4 = 64). But all triplets do occur. 61 code for 20 amino acids redundantly and 3 are stop codons which tell the ribosome to stop making the protein.
But things are not this simple because the Furin cleavage site appears in the spike protein where it needs to be and the spike protein only has 1273x3 = 3819 nucleotides. The chances of the 19 nucleotide Furin Cleavage sequence appearing in the spike protein are
(3,819-18) x (1/4)19 = 1.389 x 10-8
Or 1 in 72 million. So those would be the chances that one particular variant, say the first Covid-19 variant, had the 19 nucleotide sequence in the right place (the spike). And it did. So certainly by the balance of probabilities, and certainly beyond a reasonable doubt (1.4 in one hundred million being an unreasonable doubt) Moderna made Covid-19.
The Double CGG Codon used in the Moderna Specific Furin Cleavage site does not occur in any other Furin cleavage site in any other virus in nature. Furin cleavage sites do occur in other viruses but NOT at all in other betacoronaviruses like Covid-19 and NOT at all with the double CGG codon..
Arginine (R), can be encoded by any of the 6 triplets: AGG, AGA, CGA, CGC, CGG, CGT. In Covid-19, the furin site (PRRA), has 12 nucleotides (3 x 4). In Covid-19, the RR doublet of the furin site is encoded by CGG-CGG.
Two Biochemists Prof Antonio R. Romeu and Assistant Prof Enric Ollé analysed the RR doublet from a large sample of furin cleavage sites of several kinds of viruses. They found that there were no RR doublets encoded by the CGG-CGG codons in any virus in nature. They observed that the AGA triplet was the majority codon involved in these viral RR doublets. In all genetic recombination (where a part of one genome merges with another genome), the donor code is passed to the acceptor. But there is simply NO KNOWN VIRUS with a Moderna Specific Furin Cleavage Site (having the CGG-CGG codon pair) that exists to donate a Moderna Specific furin cleavage site to Covid19. So the only way that sequence could get into Covid-19 is from Moderna. Moderna was the donor. Nature was not. QED. Case Closed..
But it gets worse.
The Spanish Profs decided to analyse the arginine codon usage in every single protein in Covid-19. The found the following...
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%).
So the AGA codon triplet was the majority, and interestingly, CGG was the minority codon for Arginine in the virus.
But it gets worse still.
In the specific case of S protein, of the 42 Arginines (R) it has, 20 are encoded by AGA, and only 2 by CGG. These 2 of course, are the two in the Moderna Specific Furin Cleavage Site.
So the only Arginine in the spike protein that is encoded a la Moderna are in the Furin Cleavage site. The other 40 instances do not use CGG at all.
They then go on to comment that each individual species in nature has its own codon preferences. Obviously viruses like AGA, and do not like CGG at all, in nature.
But guess which species does use CGG for Arginine more than the other 5 competing codons - yes its jolly old homo sapiens. Our coding preferences for Arginine are
AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).
So the CGG codon in the furin cleavage site WILL have come about through Chimeric (human animal combination) gain of function research.
"New documents show that just 18 months before the first Covid-19 cases appeared, researchers had submitted plans to release skin-penetrating nanoparticles and aerosols containing “novel chimeric spike proteins” of bat coronaviruses into cave bats in Yunnan, China. They also planned to create chimeric viruses, genetically enhanced to infect humans more easily, and requested $14 million from the Defense Advanced Research Projects Agency (Darpa) to fund the work.
Papers, confirmed as genuine by a former member of the Trump administration, show they were hoping to introduce “human-specific cleavage sites” to bat coronaviruses which would make it easier for the virus to enter human cells.
When Covid-19 was first genetically sequenced, scientists were puzzled about how the virus had evolved such a human-specific adaptation at the cleavage site on the spike protein, which is the reason it is so infectious."
-
the Telegraph
I can see all of the great journalists at the Daily Mail and the Telegraph (not to mention scientists around the world) doing all of this research into Covid19 and reaching the inevitable logical conclusion that there was either an accidental or a deliberate lab leak and then having to word their conclusions in such a way as to label that strong probability as a weak possibility. But here above we have proved it as a fact (since the Moderna Specific Furin Cleavage Sequence CGG codon does not occur in any furin cleavage site in any natural virus and therefore it cannot have been the result of natural genetic recombination. So it has to be the result of man made genetic insertion).
In theory a further party involved with the NIAID or the NIH could have used the furin cleavage site patented by Moderna and made Covid19 themselves. this would not have broken any patent of Moderna. The Furin cleavage site itself is not patentable having been known since at least 2004
US7223390B2: Insertion of furin protease cleavage sites in membrane proteins and uses thereof
2004-05-07 Application filed by Research Development Foundation
2004-11-11 Publication of US20040224391A1
2007-05-29 Application granted
Although Moderna could actually have patented the Moderna Specific (CGG for AGA) encoding of the furin cleavage site which was is not known in nature even today (accepting that Covid-19 is man made). But given that the lab leak (deliberate or accidental) came from Wuhan, and given the Chinese cover up and given the Fauci denials exposed by Senator Rand Paul, and given the NIH, NIAID cover ups and the US Intelligence services cover up, when their 3 month long report into the origin of Covid-19 ordered by presidential impersonator Biden yielded nothing, and given the relationships between the NIAID, the NIH, the WIV, the EcoHealth Alliance, the University of North Carolina and Moderna, I cannot see any room for anyone else. Furthermore the entire unholy cabal of bad actors started developing the Moderna Vaccine before the pandemic struck - https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine-began-development-weeks-ahead-of-pandemic/
But the slam dunk proof is that Moderna's own website at https://www.modernatx.com/patents
shows the following 7 patent filings for their gene therapy mRNA-1273 (amino acid chain) vaccine...
US 10,703,789 filed January 12 2019
US 10,702,600 filed February 28 2020
US 10,577,403 filed June 12 2019
US 10,442,756 filed December 18 2017
US 10,266,485 filed June 11 2018
US 10,064,959 filed April 21 2017
US 9,868,692 filed July 27, 2017
The 2nd patent, filed on February 28 2020 was a continuation of an earlier patent application number 16/368,270 which was filed on March 28, 2019
So they had all 7 patents applied for by June12, 2019, which is quite impressive given that the WHO was only informed of a pneumonia type outbreak in Wuhan on December 31, 2019.
So all the patents needed to protect Moderna's particular vaccine monopoly were applied for more than 6 months before the outbreak of the disease that the vaccine is supposed to be curing.
This proves that the Moderna made it and that the purpose of the 'lab leak' was to make a market for pre-existing vaccines in the case of Moderna. The leak occurred to force people to have to take the vaccine.
Nature has had certainly 100,000 years to make human viruses and it never once put a Moderna specific (CGG for AGA) furin cleavage site into any virus, nor did it put the 19 nucleotide sequence in anything before. Yet within 6 years of Moderna patenting it, we find it in Covid-19 in circumstances where Moderna is working with that virus. So just there the probability is not 100,000 to 6 or 16,666 to 1 that Moderna is responsible rather than nature. No it is 100% because nature has not done it. It never has in a virus and there is no evidence that it ever will.
It is man that mixes up human and viral Arginine codons not nature.
Prof Luc Montagnier, before he died on 2022February8, did a total assassination of the concept that Covid-19 evolved naturally by showing that it had massive equivalence to HIV. The diagram below shows a 275 nucleotide region of Covid-19 which has 200 nucleotides from HIV/SIV (Simian ImmunoVirus) in it. And remember there are 61 codons specifying 20 amino acids. So one can say the same thing in on average 3 different ways with codons. You can download a pdf of his study here and the supplementary materials here. It is very technical. But he did win the Nobel prize for discovering the HIV virus. So if anyone would know if Covid had been boosted with HIV, it would be him. He pointed out that Covid-19 was man made early in the pandemic and was himself assassinated by the press and the fact checkers as a result. Every single fact checker who attacked him was wrong. There was no scientific basis to any of their fact checking. These outfits are not fact checkers at all of course. They are globalist disinformation agencies, sons of Goebbels, fact chuckers and science deniers. They are about as trustworthy as an American election. I can check a fact for myself thank you very much. I don't need a brainwashed woke madrassa student telling me their opinion about a subject that they never studied at University.
Since we have proven beyond a reasonable doubt (beyond a 1 in 72 million doubt statically and with 100% certainly biochemically from the Moderna Specific Furin Cleavage Site) that Moderna made Covid-19. And since Moderna and Fauci have not admitted to having made it and have in fact covered up evidence to that effect, it may be the case that they are hiding something else as well. Because the only two theories now left are the accidental lab leak theory and the deliberate lab leak theory. I mean the vast majority of political leaks are not accidents. They are deliberate strategies to provide advantage to the leaker or his paymaster. It is well known in the IT industry that viruses appear when antivirus sales are needed. Why would things be any different with human viruses, now that they can be man made too? Especially when you consider the massive role of Bill Gates and his foundation and GAVI and GVAP in he global vaccination business.
The only reason that Moderna would make Covid-19 is to release it. Otherwise the entire exercise would be financially futile, commercially futile
The reason adduced by Fauci for doing gain of function research is that man needs to be ahead of nature or bad actors in order that they will have a vaccine in good time if a disease mutates or is genetically modified by the Chinese or the Russians to be lethal.
But in order to believe that one has to believe that Moderna are interested in the saving people's lives. I am sorry. All their actions show to me that they are interested in vaccinating people knowing how likely that is to cost them their lives.
They are interested in profit, the profit that comes from a pandemic. They are not our saviours as they represent. They are our abusers.
They produced the virus in order to leak it not in order to save mankind. They are not our saviours. Luc Montagnier was trying to be our saviour from them and he was assassinated (professionally) their groupies. Moderna were doing gain of function research in order to release the virus and force a vaccine for it in a manner which would maximise their profits. That is not a conspiracy theory. It is what happened precisely. Their share price went up by 20x.
They released it in order to sell their vaccines and to destroy the immune systems of their customers because our immune systems reduce their profits. That is the Pharma business.
The reason that the writer is so confident that Moderna or their agents made and leaked Covid-19 and the reason I called it as such at the start of the pandemic to almost as much ridicule as Prof Montagnier received (God bless him) is that the scriptures say in Matthew27, Mark15 and John19 that.
29 And they (the soldiers of the governor of verse 27)
platted a crown of thorns and put it upon his head, and a reed in his right hand; and they kneeled down before him, and mocked him, saying, Hail, King of the Jews!
30 And they spat upon him, and took the reed and smote him on the head. (Matthew 27 ASV)
May I therefore beg your indulgence whilst I interpret these words:
The US department of defence funded the gene splicing of the Coronavirus of Spike Proteins (Covid-19) through NIH and NIAID and DARPA which first infected Jesus, through his fiance, the New Covenant Saints, just after he became the secular King, Caesar to those saints, the antitypical Jews, those covenanted to be angelic sons of Jacob, the born agains angelically. We calculated that the malediction which prevented Jesus becoming Caesar to the saints ended in 2019Tishri15 (October17/18). Glenn Beck did a documentary showing that 10 hospitals in Wuhan took cases with Covid19 symptoms in October 2019. Yes Folks. Covid-19 is a proof that Jesus is now secular King over the saints, the antitypical Jews, the Jews by angelic salvation covenant, at the least. [Ed but only those who have died in their human bodies by Passover execution and been resurrected into the ark, that is the 1NCs and the HLCs of the 3rd Holy Spirit. He does not become Caesar to Abraham until 2022Chislev5 and Adam until 2022Chislev6 and Isaac until 2022Tebbeth5 and Cain until 2022Tebbeth11].
But then the soldiers spat upon him. For that is how Covid19 is transferred, through small aerosol droplets exhaled out of the mouth. The soldiers deliberately spat upon him. It was not a SALIVA LEAK! They smote Jesus on the head because the saints are the head of the church and they caught Covid19 not by random chance infection but by a deliberate smiting with a read, a biological weapon, a deliberate weaponised attack. For more on this see here.
So what Prof Montagnier saw with his virology expertise, I saw with my theological expertise. Showing that whilst fact checkers and science are mutually exclusive, science and theology actually agree, when properly understood (and that is one big caveat). Prof M taught us that the vaccines cause the variants. Indeed basic virology forbids mass vaccination during a pandemic for that very reason. He said the the curve of deaths follows the curve of vaccinations. Mind you, paradoxically, if the vaccines caused Omicron, then they saved us from themselves!
The Covid19 makers, the genetic vaccine makers. their funders and their promoters, which include almost every government and public sector and health service in the world, are therefore guilty of Genocide and crimes against humanity. They have pushed genetic rape and sickness and death onto half of the population of the world in order to enrich the pockets of Pharmaceutical Companies. Governments and Public sectors around the world have abandoned their health service regulation to billionaires and heartless corporations
In the UK, all of the income tax we pay goes to the health service and all of its protocols are determined by its regulators and all of its regulators are controlled and funded by Big Pharma who seek to damage then manage our health for their profit.
So every penny we spend in income tax brings us one step closer to sickness, to death and to drug dependency.
So why did Prof Montagnier choose to spend the last years of his life proving that Covid-19 was man made and that the spike proteins, and therefore the vaccines, were an existential threat to the species? What did he have left to prove to himself or to anybody else at 87-89? He certainly did not do it to increase his reputation in the profession. No he was driven by the same passion that drove him to discover HIV. A passion to SAVE mankind from viruses and those who would engineer them to damage us. And why did he give up the ghost in February 2022? Because he knew that Omicron had the vaccines beat. His job was done by a greater virologist even than him. He could therefore rest in peace and go see some people who understood the magnitude of his contribution.
Covid-19 was not made in 2019. It was made from the 19 nucleotide Moderna specific chimeric (CGG for AGA) furin cleavage site which does not occur anywhere in nature.
And every Covid death and every Covid vaccine death is parked squarely on their doorstep waiting for justice.
But we shall not execute that justice fast enough and therefore the final plague upon mankind of Revelation 6:8, delivered by the 4th horseman of the apocalypse, which plague Bill Gates himself has prophesied, will arrive later this year (after War and after Famine, the 2nd and 3rd horsemen).
____________________________
The worst thing a crowd of people can do is to watch a gang of thugs beating a man or raping a girl and do noting about it. Especially when the crowd is much larger than the gang.
Yet this is the precise position we are in with Ukraine and Russia with whole nations rather than with individual people. And in Ukraine children are being killed too.
Anyone who thinks that the war in Ukraine is not a threat to the rest of the planet is in denial. Every day that Putin is permitted to continue bombing Ukrainian cities, makes the world a more dangerous place. Every day that we ignore the pleas of our brothers in Ukraine and in Russia to stop this war, is a wasted day.
We must do something that the chess player did not factor into his cold inhuman calculations for war, that he made before promising not to invade Ukraine.
That something is not to declare war on Russia. But to declare defence on Ukraine and to send in the military there for that purpose alone (I suggest). It is a declaration of war on those Russian or Belarusan forces attempting to recolonise Ukraine for the greater glory of the frozen race. Frozen in time, that is, as they attempt to rebuild the self defeating Soviet Union.
Sure Putin is not the only bad actor here. The West interfered in the coup-revolution that removed Yanukovich in 2014. But the Orange Revolution in 2004-2005 had removed his rigged election result 10 years earlier and gave us Yulia Tymoshenko, the blond bombshell of Ukrainian Independence, who was prime minister from February to September 2005 and from 2007 - 2010.
She lost the election to Yanukovich in 2010 and was sentenced to prison for 7 years in 2011, for nearly winning an election. Sorry for not doing what Putin wanted with a gas deal. OK for abusing her office over a deal with Gazprom. But this was a very selective use of the law and she essentially became a Putin type political prisoner. She was released in 2014 by a parliamentary vote as a direct result of the 2014 Revolution-Coup, after 3 years in prison. CBC describes her persecution as follows...
Ukraine's jailing of former prime minister Yulia Tymoshenko was a politically motivated violation of her rights, Europe's human rights court has ruled. A Ukrainian ambassador stormed out of the courthouse in response to the ruling in a case that has strained the former Soviet state's ties with Europe and the United States.
An architect of Ukraine's 2004 pro-democracy Orange Revolution who was instantly recognizable by her crown of braids, Tymoshenko was sentenced to seven years in prison in October 2011 after being convicted of exceeding her powers as prime minister while negotiating a gas contract with Russia. Tymoshenko has said her jailing was intended to keep her out of politics and that her rights were violated when she was first jailed in August 2011. The court agreed unanimously that her jailing was "for other reasons" than those permissible by law. - https://www.cbc.ca/news/world/ukraine-s-jailing-of-ex-pm-tymoshenko-ruled-a-rights-abuse-1.1375827
I am no expert in Ukrainian history. But we are all experts in abuse on this planet because we see it every day of our lives. War is the ultimate form of abuse that man indulges in and the time has come to stop it at all costs.
The Russians said at the time of appeasement before WW2, that the British have avoided a small war now but ensured a large war later. It would appear that our Churchillian Prime Minister has not studied the history of the English speaking people closely enough. For we are making precisely the same mistake today that we made in 1938.
Putin is a chess player, a prober, an opportunist and at heart an imperial nationalist for Russia. He now sees the woke British and American militaries, who are trained not to attack people even with pronouns, and not to offend them even with language, and who cannot fight off the flu without umpteen gene altering vaccinations, as the weakest they have ever been in his entire life. The war in Ukraine is a total failure of US and UK Intelligence services to read Putin. And he is not a hard or a long read. If we look weak, then he will attack and that attack may well come to our door.
We lost Ukraine when we withdrew our soldiers from Afghanistan and left our civilians there to be abused and killed by the Taliban. Thousands of American citizens may still be trapped their because the 'Whoever is the real President' administration of the US never told us the true number of Americans whom they abandoned to the Taliban and neither did the foreign Office tell us how many Brits were deliberately sacrificed. At least our soldiers were permitted to get them out if they could find them or get to them.
But let's face it shall we? If we cannot rescue our own nationals from Afghanistan, why would Putin worry about us rescuing Ukrainian nationals from the teeth of the bear?
There is only one way to save them and that is to lead BY EXAMPLE and to care more about Ukrainian nationals in their hour of need than we did about our own in their hour of need. Because if we do not, we may lose both Ukraine, Great Britain and everything in between. And none of the generals responsible for the dereliction of duty in Afghanistan should be involved in the salvation of Ukraine unless they strongly objected and were overruled. I do not call for their sacking because I do not subscribe to cancel culture and because the problem lies in the MOD more than it does in the armed forces.
Boris has a really really difficult job to do from now onwards and he will have to be better than Churchill to pull it off. Our military has been eroded to the point where without the Americans it is at a significant disadvantage to the Russians. Whoever is the president of the US is a globalist crook and a traitor to the US and a democratic fraud, having never received one vote. And he or she, being the chief of the armed forces, engineered the Afghanistan disaster to tempt Putin into Ukraine. Afghanistan was an open invitation to Putin. It was the globalists telling him: We have succeeded in neutralising the US and UK military power. You are free to do whatever you want. Putin does not want WW3. He wants an empire. Whereas the globalists want a world empire and they need WW3 to expedite that goal..
The big danger here is WW3. We should do everything possible to avoid it. And the way to do that is to show Putin who he is dealing with and to undo the pathetic optical moral and tactical display we put up in Afghanistan.
It will be a fine line, to attempt to show Putin we mean business, without triggering WW3. But if we lose Ukraine WW3 is almost a certainty. Whereas if we win Ukraine WW3 is dead.
Ukraine is the door to WW3. We need to close that door without triggering that war. We will not manage such a delicate operation with the present self serving MOD bureaucracy and that is the difficulty Boris faces. If we fail to defend Ukraine Putin will have calculated correctly and will then be emboldened to expand further into Europe and trigger NATO and WW3.
Of course in an ideal world we would have international law with which to charge Putin and arrest him and try him and convict him and imprison him like he has done to so many of his adversaries. But there is not much political will to arrange such law because many politicians are as lawless as he is. They see laws as being made by them but obeyed by everyone else. They are not too keen on being under someone else's law themselves. So every nation on this earth is forced to settle its dispute with its neighbour in the manner of a lawless drug dealer with no recourse to the police - by his own gun.
The globalists have infiltrated the five eyes governments (the UK, the US, Canada, Australia and New Zealand) sufficiently to engineer the catastrophe of Afghanistan which was the invitation to Putin to invade Ukraine. Sufficiently to engineer absurdly repressive and totally counterproductive lockdowns and mask and vaccine mandates. Their next play is to trigger WW3. The trigger will be a false flag in the UK and a false flag in the US in March (if I am not mistaken). So the purpose of this trigger is to start WW3. The purpose of WW3 is to enable the global reset. The destruction of WW3 is the foundation from which the globalists want to build back better. I mean you have to knock down first before you can build back better.
We must do everything possible not to be triggered and to recognise these coming triggers as globalist seditions, as 911s. It is not like we haven't seen this before. We should be guided by empathy for our Ukrainian brothers, not by globalist power games.
So we need to defend Ukraine whilst it is still outside of Russia. Because once it is eaten by the bear, it will be too late. Putin has calculated that we will not do that. This is precisely why we should do it. But we must be as smart and as smooth as Putin in making the distinction between coming to the aid of a nation in trouble and attacking Russian territory. Perhaps we should send Peacekeepers like Putin did into Donetsk and Lugansk. And perhaps, our peacekeepers will be even less successful than his at keeping the peace in Ukraine? Or perhaps we should declare a couple of Ukrainian provinces to be a part of the British Empire by writing an agreement between the Queen and the Prime Minister to that effect?
Whatever it is that we normally do, whatever our normal response is, we must do the opposite, and fast.
Putin has done everything in his power to stop Ukraine and Georgia becoming a part of NATO. Perhaps we should treat them as though they are anyway? We can choose to treat them however we like, until we are conquered by Putin that is..
Perhaps we could donate the British Military to the Ukrainian military and fight in the colours of Ukraine? Perhaps the entire EU should do that?
The most helpful suggestion I believe I can make is to demote the entire Afghanistan compromised upper management of the MOD, all of it, every branch of it, both covert and overt, and replace it, lock stock and barrel, with retired Military personnel - forthwith. Lets get some people who know a bit about military conflict running the show - whilst there is still a show left to run. Otherwise we could be looking at the last night of the Proms.
We should offer to take Russian POWs as refugees into the UK, detained until the end of the war. We should treat then properly in accordance with the Geneva convention. Ukraine does not have the resources to do that presently. that would be a load off their minds that we can carry. It will not make us a target if we treat them with dignity. Maybe Abramovich could fund that exercise helping both Ukraine and the Russian POWs?
Bear in Mind that in the end times, the test on man is do you have love? And war is the biggest test man ever faces. Unfortunately it is an integral part of the final test.
Presidential Impersonator Biden does not have the authority either to choose a question or to answer it without a script. Jen Psaki does have both of those authorities. So it is obvious that Psaki is above Biden in the present white house administration.
It is equally obvious the Joe Biden is not the true President of the US. Furthermore it is apparent, from his many senior moments, that he does not have the intellectual capacity to be the commander in chief of the US armed forces. If he cannot fend off a question from a journalist, then neither can he repel a military adversary.
This is the most obvious democratic fraud I have seen in my life and nobody treats it as such. I am not talking about the vote rigging fraud of the 2020 US election. I am talking about a hidden president who did not get one vote.
The true President of the United States, whoever he or she is, is the most obvious electoral fraud in the history of democracy. They did not even stand for election.
Why has this hidden president not been impeached on those grounds?
The democratic party should be taken to court and forced through the disclosure process to inform the US public who the real president actually is.
Then that president should be impeached for failing to stand in the 2020 presidential election and for getting no votes and yet engineering a presidency for themselves and for democratic treason.
WILL THE REAL US PRESIDENT PLEASE STAND UP SO WE CAN IMPEACH HIM OR HER
World leaders are no longer taking Biden seriously because they do not want to speak to the monkey. They want to speak to the organ grinder. But they have no idea who is grinding the organ (if you will pardon the metaphor).
The abandonment of thousands of US citizens and billions of dollars of high spec military equipment in Afghanistan was not a mistake. It was a deliberate act of treason by a clandestine president who is anti American and anti democratic and almost certainly a globalist plant. I mean how do we know he or she is even American?
The abandonment of the fully functional weapons grade biolabs in Ukraine is a second very similar act of treason that has now established a pattern of behaviour. The guy at the top is deliberately trying to screw America in every way imaginable. .
VICTORIA NULAND: Ukraine has a biological research facilities, which, In fact, we are now quite concerned Russian troops, Russian forces, may be seeking to gain control of. So, we are working with the Ukrainians on how they can prevent any of those research materials from falling into the hands of Russian forces should they approach. - https://www.foxnews.com/opinion/tucker-we-have-right-know-this
Instead of leaving 85 billion dollars of military hardware behind in Afghanistan, they left all their bioweapons behind in Ukraine. Why were these labs not dismantled or neutralised not by the Ukrainians post invasion but by the Americans pre invasion? Was it because the US wanted Putin to invade? These labs must breech agreements with Russia about not putting WMDs in Ukraine. It puts Ukraine into a Cuban Missile Crisis situation, which could well justify the military action we have seen by Russia to remove that threat. Although Russia did not cite those labs as its pretext for invasion.
So who is this democratic fraud, this military fraud, this anti American assassin, this globalist plant, this snake on the plane?
It cannot be it Kim Jong Un, no missiles have been fired
It cannot be John Cleese, the administration has no sense of humour at all
It cannot be Kim Kardashian, the white house decor is way to cheap
It could be the CEO of Dominion. Nobody voted for him, but that did not stop him getting all the votes.
It could be Rachel Madcow - if the workload of holding down one job at MSNBC and another at the Whitehouse proved too much for her?
It could be Klaus Schwab: He did say that the WEF had penetrated every level of government.
It could be Putin actually. Everything the non Biden administration has done so far has been to his military advantage. Or maybe Putin is in fact the US Defence Secretary?
I mean this situation gives us all an unprecedented opportunity to see behind the veil. Every US president, and every British Prime minister is to some extent a puppet of various undemocratic actors (intelligence services, billionaires, mega corporations etc). How much room they really have to operate has never yet been revealed. Putin did say to Megan Kelly. But Biden is the most transparent puppet there has ever been. You can see the hand that is operating him. We just have not yet seen the face.
So by investigating him we could discover a level of fraud which have been in existence for decades.
Every US congressperson is unfortunately a conspirator in this zero vote Presidential fraud. ALL OF THEM. They are all alike pretending that Biden in the President when it is obvious to anyone with more than two unvaccinated brain cells that he is not. That is a fraud. Congress needs to step up and clean house. The entire administration needs to be impeached after the true president is revealed. This present democratic administration is making a total mockery out of the US constitution, US democracy and US government. In fact any journalist who attends a white house press briefing and fails to ask Psaki: Who is the real president is condoning the fraud.
The vote counting fraud, endemic to the 2020 presidential election, is hard to prove. The puppet fraud, could not be easier to prove and it is ongoing. Every day that Biden pretends to be the US president is another day of outright blindingly obvious electoral fraud. How long are Politicians and Journalists going to be willfully blind to it?
STEP 0: The genome, the complete genetic code of Covid19 is found here - https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2/ The genome of Bat Coronavirus RaTG13 is found here - https://www.ncbi.nlm.nih.gov/nuccore/MN996532
One can compare these two genomes, letter by letter using the BLAST Genome alignment comparison tool at https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq
Just put NC_045512.2 in the Query Sequence Box and MN996532 in the Subject Sequence Box. Then choose the radio button:: More dissimilar sequences (discontinguous megablast). Then hit BLAST. Then when the results appear (a few seconds later) choose the Alignments tab and you will see both genomes compared perfectly. For the entire comparison see here
A is the base Adeninie
C is the base Cytosine
G is the base Gaumine
T is the base Thymine (not Thiamine which is a Vitamin added to Cornflakes)
The two genomes (full genetic codes) are 96% Identical. Here are all the differences...
There are 995 instances of a 1 letter mismatch
There are 24 instances of a 2 letter mismatch
There are 4 instances of a 3 letter mismatch
There are no further mismatches
There are 2 instances of a 1 letter omission at lines numbered 27341 and 29800.
There are 2 instances of a 2 letter omission at lines numbered 22981 and 23038
There are 2 instances of a 3 letter omission at lines numbered 3301 and 26504
There is one instance of a 12 letter omission at line numbered 23576
There are no further omissions.
Here are all the omissions
RatG13 3301 AGAGATGGAACCTACACCAGTTGTTCAGACT---GAAGTGAATAGCTTTAGTGGTTATTT 3357
Covid19 22981 TCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTC--CTTTA 23038
RatG13 23038 TA--GATATGGATTTTACCCTACTGATGGTGTTGGTCACCAACCTTATAGGGTAGTAGTA 23095
RatG13 23576 AGTTATCAGACTCAAACTAATT------------CACGTAGTGTGGCCAGTCAATCTATT 23623
RatG13 26504 AGCCATGGCAGAT---AACGGTACTATTACCGTTGAAGAGCTGAAAAAGCTCCTTGAACA 26560
RatG13 27341 ATGAAGAGCAACCAATGGAGATTGATT-AACGAACATGAAAATTATTCTTTTCTTGGTAC 27399
RatG13 29800 ATTTTAGTAGTGCTAT-CCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAA
29855
And that is it. There are no further differences. The overall match is 28723 letters out of 29877(96%). The total numbers of gap letters is 24 (12+3+3+2+2+1+1).
Natural mutations normally occur one letter at a time. So to determine whether or not Covid19 is man made we just have to look at the 12 letter gap, which is way too large for a series of random mutations that just happened to occur right next to each other in a 29877 letter genome, and all in the 6 years between 2013 (when RatG13 was sequenced) and 2019 when Covid-19 appeared, So the extra 12 letters, the extra 12 bases, the extra 12 nucleotides (base + sugar + phosphate) were inserted from another genome, either by nature or by man.
Covid19 23579 AGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATC 23638
|||||||||||||| |||||||
|||||||||| || |||||||| ||
RatG13 23576 AGTTATCAGACTCAAACTAATT------------CACGTAGTGTGGCCAGTCAATCTATT 23623
Each 3 letter group (called a codon) codes for one amino acid. So the inserted group in whole codons is actually...
TCT CCT CGG CGG GCA which codes for SPRRA (Serine, Proline, aRginine, aRginine, Alanine).
But the Furin Cleavage Site is PRRAR which includes the next Codon CGT which also codes for aRginine (R).
So the only difference between Covid-19 and RaTG13 which involves more than 3 nucleotides (more than one complete 3 letter Codon) is the Furin Cleavage Site which involves 12 nucleotides and parts of 5 Codons (15 nucleotides).
STEP 1: Run a BLAST virus search https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/ to see if this sequence (TCTCCTCGGCGGGCA) occurs in any virus in nature other than Covid19. Answer: It does not.
Search also for CTCCTCGGCGGGCA - Answer: It does not occur in any natural virus.. One cannot search just for the 12 letters CCTCGGCGGGCA because the search must have 14 letters minimum for some reason.
Search also for CCTCGGCGGGCACGT which codes for PRRAR, the famous Furin Cleavage site, which gives Covid-19 its gain of function infectivity - Answer: It does not occur in any natural virus.
STEP 2: Run a Patent BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn and make sure 'align 2 or more sequences' is unchecked and chose patent sequences) search of every patent application for the 14 nucleotide sequence CTCCTCGGCGGGCA which is the 12 nucleotide insert plus the rest of the final 3 letter codon, the next two letters. We have to do this because the BLAST searches need a minimum of 14 letters. You cannot do a BLAST search for 12 nucleotides. In the Algorithm Parameters section set max targets to 5000.
Here are the results...
US5606032A: Process for preparing glial mitogenic factors
Description: The most disgusting imaginable method of obtaining a 745 base pair sequence of DNA from Bovine pituitary glands which has the wonderful capability of stimulating the division of rat Schwann cells in when resident in fetal calf blood plasma.
Inventor: Andrew Goodearl, Paul Stroobant, Luisa Minghetti, Michael Waterfield, Mark Marchioni, Mario S. Chen, Ian Hiles
Current Assignee: Ludwig Institute for Cancer Research Ltd, Acorda Therapeutics Inc
1991-04-10: Priority to GB919107566A
1995-06-06: Application filed by Ludwig Institute for Cancer Research Ltd, Cenes Pharmaceuticals Inc
1997-02-25: Application granted and published
2017-02-25: PATENT EXPIRED
So the first patented appearance of the 14 nucleotide insertion was in a 745 nucleotide sequence extracted from Cow's pituitary glands and published in 1997 at the beginning of the public internet!
US5958721A: Methods for screening of substances for therapeutic activity and yeast for use therein
Inventor: Christopher John Marshall, Alan Ashworth, David Anthony Hughes
1993-04-07: Priority to British Patent GB9307250
1994-03-31: Application filed by Cancer Research Campaign Technology Ltd
1999-09-28: Application granted and published
2099-09-28: PATENT EXPIRED
Description: Candidate pharmaceuticals for use in treatment of cancer, inflammatory disorders, cardio-vascular disorders or neurological disease. - Pretty much all the side effects of mRNA vaccines !
They used the mammalian MAPKK (Mitogen Activated Protein Kinase Kinase) gene sequence (containing the 14 nucleotide insert sequence) in yeast to screen for anti cancer capability. They did not use it in a virus.
US6074828A: Amino acid transporters and uses
Description: DNA encoding human amino acid transporters.
Inventor: Susan G. Amara, Jeffrey L. Arriza
Current Assignee: Oregon Health Science University
1998-03-17: Application filed by Oregon Health Science University
2000-06-13: Application granted and published
2020-06-13: PATENT EXPIRED
So the 14 nucleotide sequence exists in humans as well as cows.
US6833447B1: Myxococcus xanthus (a bacterium) genome sequences and uses thereof
Inventor: Barry S. Goldman, Gregory J. Hinkle, Steven C. Slater, Roger C.
Wiegand,
2001-07-10: Application filed by Monsanto Technology LLC
2002-01-11: Assigned to MONSANTO TECHNOLOGY LLC
2004-12-21: Application granted and published
So the 14 nucleotide gene sequence exists in humans, in cows, and in bacteria. And it has been used in yeast.
Patent monopolies last for 20 years. So some of these monopolies granted on a novel use of naturally occurring DNA from humans, cows and bacteria, expired before Covid19 came along. But it was actually the British who started isolating and using DNA containing the 14 base pair insert first - woops!.
STEP 3: In order to make the sequence into a Furin cleavage site which gives the virus its infectivity, we must add the final Arginine codon CGT and get the 17 nucleotide sequence CTCCTCGGCGGGCACGT, which we call the double CGG coded furin cleavage site insert.
We now run a BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn make sure align 2 or more sequences in unchecked and chose patent sequences) of every patent application for the 17 nucleotide Furin Cleavage Site sequence CTCCTCGGCGGGCACGT. Here are all the 100% match results (dated before the arrival of Covid19 in October 2019 according to Glenn Beck.
US9587003B2: Modified polynucleotides for the production of oncology-related proteins and peptides
- https://patents.google.com/patent/US9587003B2/en
Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M.
Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P.
Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2016-02-04 Application filed by ModernaTx Inc
2017-03-07 Application granted and published
US9301993B2: Modified polynucleotides encoding apoptosis inducing factor 1 - https://patents.google.com/patent/US9301993B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2016-04-05 Application granted and published
2020-01-10 First worldwide family litigation filed
US9255129B2: Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 - https://patents.google.com/patent/US9255129B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2016-02-09 Application granted and published
US9216205B2: Modified polynucleotides encoding granulysin - https://patents.google.com/patent/US9216205B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2015-12-22 Application granted and published
US9149506B2: Modified polynucleotides encoding septin-4 - https://patents.google.com/patent/US9149506B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2015-10-06 Application granted and published
2020-01-10 First worldwide family litigation filed
Sequence 11651 from patent US 9149506
Sequence ID: HL240349.1
Range 1: 2762 to 2778
Plus/Minus (this means the match is for the reverse compliment of the sequence which is CTCCTCGGCGGGCACGT because A bonds with T and C bonds with G.
Query 1
CTCCTCGGCGGGCACGT 17 CTCCTCGGCGGGCACGT Plus DNA strand
|||||||||||||||||
|||||||||||||||||
Sbjct 2778 CTCCTCGGCGGGCACGT 2762
GAGGAGCCGCCCGTGCA Minus DNA strand
Query 1
TGCACGGGCGGCTCCTC 17 Reverse Plus DNA strand
|||||||||||||||||
Sbjct 2778 ACGTGCCCGCCGAGGAG 2762 Reverse Minus DNA strand
2761 tacgtgcccg ccgaggaggc caccatcggc atcgtggacg gcatcttcac cagaatgggc
US9024113B2: Polynucleotides for expression of microbial starch branching enzymes in plants for production of plants with improved yield
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry S. Goldman, Current Assignee: Monsanto Technology LLC
2007-10-29: Application filed by Monsanto Technology LLC
2014-04-18: Assigned to MONSANTO TECHNOLOGY LLC
2015-05-05: Application granted and published
Monsanto used the sequence to genetically modify plants, not humans.
US8952217B2: Process for decreasing verbascose in a plant by expression of a chloroplast-targeted fimD protein
Inventor: Piotr Puzio, Birgit Wendel, Michael Manfred Herold, Ralf Looser,
Astrid Blau, Gunnar Plesch, Beate Kamlage, Florian Schauwecker
Current Assignee: BASF Metabolome Solutions GmbH
2006-09-06: Application filed by Metanomics GmbH
2015-02-10: Application granted and published
BASF used the gene sequence for the Genetic Modification of plants.
US8372601B2: Compositions and methods for the synthesis of APPA-containing peptides (as antibiotics)
Inventor: William W. Metcalf, Wilfred A. van der Donk, Junkal Zhang, Benjamin T.
Circello,
Svetlana A. Borisova
Current Assignee: University of Illinois at Urbana Champaign
2011-01-21: Application filed by University of Illinois at Urbana Champaign
2011-02-28: Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN
SERVICES (DHHS), U.S. GOVERNMENT
2011-05-13: Assigned to UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN
2013-02-12: Application granted and published
"Exemplary vectors suitable for replication in mammalian cells may include viral replicons, or sequences that ensure integration of an embodiment of the isolated nucleic acid of the present disclosure into the host genome. Suitable vectors may include, for example, those derived from simian virus SV40, retroviruses, bovine papilloma virus, vaccinia virus, and adenovirus"
"Expression of proteins encoded by an embodiment of the isolated nucleic acid of the present
disclosure then occurs in cells or animals which are infected with the live recombinant
vaccinia virus."
This patent is about manufacturing proteins containing the amino acid sequence APPA. Covid19 does contain that sequence but not in the spike protein, which has the furin cleavage site. The patent claims DNA similar to Patent gene sequences 2,3,4 and 5-13. Whereas the Furin Cleavage site occurs in Patent gene sequence 14. So it is incidental to the patent.
US7635798B2: Nucleic acid compositions conferring altered metabolic characteristics
Description: This invention encompasses the identification and isolation genes and gene fragments that confer altered metabolic characteristics in Nicotiana benthamiana plants, when expressed using GENEWARE™ viral vectors.
Inventor: Thaddeus Weglarz, Daniel Gachotte, Beth Blakeslee, Ignacio Larrinua,
David A. McCrery, Randy J. Pell, J. Vincent B. Oriedo, Barbara A. Miller, Avutu S. Reddy, Vipula Shukla, Rodney Crosley
2002-08-30: Application filed by Dow AgroSciences LLC
2004-10-01: Assigned to DOW CHEMICAL COMPANY, THE
2005-01-14: Assigned to DOW AGROSCIENCES LLC
2009-12-22: Application granted and published
Dow Agrisciences was using viruses to Genetically modify Tobacco plants.
US7314974B2: Expression of microbial proteins in plants for production of plants with improved properties
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry S. Goldman
2003-02-20: Application filed by Monsanto Technology LLC
2003-08-25: Assigned to MONSANTO TECHNOLOGY LLC
2008-01-01: Application granted and published
Monsanto used the gene sequence in their genetic modification of plants not humans or viruses.
US6869788B2: DNA encoding novel D-aminoacylase and process for producing D-amino acid by using the same
Inventor: Masami Osabe, Katsuyuki Takahashi, Toshifumi Yamaki, Teruo Arii,
Toshihiro Oikawa
2002-02-01: Application filed by Mitsui Chemicals Inc
2002-09-30: Assigned to MITSUI CHEMICALS, INC.
2005-03-22: Application granted and published
Not to do with viruses.
STEP 4: Run a BLAST
(Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi
chose Blastn make sure 'align 2 or more sequences' is unchecked and chose patent sequences) of every patent application for the 15 nucleotide Furin Cleavage Site sequence CCTCGGCGGGCACGT, which codes for PRRAR, Here are all the 100% new match results.
US6833447B1: Myxococcus xanthus (a bacterium) genome sequences and uses thereof
Inventor: Barry S. Goldman, Gregory J. Hinkle, Steven C. Slater, Roger C. Wiegand,
2001-07-10: Application filed by Monsanto Technology LLC
2002-01-11: Assigned to MONSANTO TECHNOLOGY LLC
2004-12-21: Application granted and published
The usual Monsanto team. So the CGG coded Furin Cleavage Site does exist in bacteria in nature, but not in viruses in nature.
US6912470B2: Genes and proteins involved in the biosynthesis of enediyne ring structures
Inventor: Chris M. Farnet, Alfredo Staffa, Emmanuel Zazopoulos,
Current Assignee: Thallion Pharmaceuticals Inc
2002-05-21: Application filed by Ecopia Biosciences Inc
2005-06-28: Application granted and published
Enediyne rings are cancer torpedoes. Ecopia were trying to improve the functionality and production of these torpedoes, which are not proteins. .
US7314974B2: Expression of microbial proteins in plants for production of plants with improved properties
(Transgenic Plants)
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry S. Goldman
2003-02-20: Application filed by Monsanto Technology LLC
2003-08-25: Assigned to MONSANTO TECHNOLOGY LLC
2008-01-01: Application granted and published
US7750207B2: Transgenic plants:
Inventor: Kunsheng Wu, Santanu Dasgupta, Targolli L Jayaprakash, Shoba Cherian
Current Assignee: Monsanto Technology LLC
2006-09-01: Application filed by Monsanto Technology LLC
2010-07-06: Application granted and published
US7834146B2: Recombinant Polypetides Associated with Plants
Description: The Polypeptides may be promoted in the plants through Plant viruses such as the Cauliflower Mosaic Virus.
Inventor: David K. Kovalic, Yihua Zhou, Yongwei Cao, Scott E. Andersen, Michael D. Edgerton, Jingdong Liu
Current Assignee: Monsanto Technology LLC
2004-01-29: Application filed by Monsanto Technology LLC
2010-11-16: Application granted and published
So Ecopia was the first to file a human therapeutic use of the double CCG Furin Cleavage site insert in the form of better Enediyne ring cancer torpedoes on 2002May21
Dow Agrisciences was the first to file a patent to use it in a plant virus in 2002August30
The University of Illinois was the first to file a patent for the use the double CGG Furin Cleavage Site insert in a human virus on 2011January21. But they were trying to make APPA containing proteins as antibiotics. The Furin Cleavage Site was incidental to their patent.
Moderna is the only other outfit to file a human use of the insert before 2019.
They filed 5 patents using the insert from 2013December16 to 2016February4. They were the last 5 patents filed using it before Covid19 broke out in October 2019.
STEP 5: Run a BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn make sure 'align 2 or more sequences' is unchecked and chose all genomes and choose complete genomes) search of microbes for the 15 nucleotide Furin Cleavage Site sequence CCTCGGCGGGCACGT, which codes for PRRAR. It finds more than a thousand bacteria known to have this gene sequence! Myxococcus Xanthus has it 209 times!
So over a thousand bacteria have multiple copies of it. Humans have it. Cows have it. Plants have it. But no viruses have it at all except Covid19.
If nature was going to give it to viruses it would have done it by now, like it did with humans, like it did with cows, like it did with bacteria and like it did with plants..
The final codon completed inserted gene sequence CTCCTCGGCGGGCA does not exist in natural viruses and neither does the CGG coded Furin Cleavage site CCTCGGCGGGCACGT which codes for PRRAR. But they do exist naturally in bacteria and in humans and in cows and in plants. Viruses can invade bacteria and insert their genes into the them. But bacteria cannot insert their genes into viruses. So the only way for bacterial DNA to end up in a virus is by human intervention. So Covid19 must have been man made.
The Double CGG Codon used in the Moderna Specific Furin Cleavage site does not occur in any other Furin cleavage site in any other virus in nature. Furin cleavage sites do occur in other viruses but NOT at all in other betacoronaviruses like Covid-19 and NOT at all with the double CGG codon..
Arginine (R), can be encoded by any of the 6 triplets: AGG, AGA, CGA, CGC, CGG, CGT. In Covid-19, the furin site (PRRA), has 12 nucleotides (3 x 4). In Covid-19, the RR doublet of the furin site is encoded by CGG-CGG.
Two Biochemists Prof Antonio R. Romeu and Assistant Prof Enric Ollé analysed the RR doublet from a large sample of furin cleavage sites of several kinds of viruses. They found that there were no RR doublets encoded by the CGG-CGG codons in any virus in nature. They observed that the AGA triplet was the majority codon involved in these viral RR doublets. In all genetic recombination (where a part of one genome merges with another genome), the donor code is passed to the acceptor. But there is simply NO KNOWN VIRUS with a Moderna Specific Furin Cleavage Site (having the CGG-CGG codon pair) that exists to donate a Moderna Specific furin cleavage site to Covid19. So the only way that sequence could get into Covid-19 is from man.
But it gets worse.
The Spanish Profs decided to analyse the arginine codon usage in every single protein in Covid-19. The found the following...
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%).
So the AGA codon triplet was the majority, and interestingly, CGG was the minority codon for Arginine in the virus.
But it gets worse still.
In the specific case of S protein, of the 42 Arginines (R) it has, 20 are encoded by AGA, and only 2 by CGG. These 2 of course, are the two in the Moderna Specific Furin Cleavage Site.
So the only Arginine in the spike protein that is encoded a la Moderna are in the Furin Cleavage site. The other 40 instances do not use CGG at all.
They then go on to comment that each individual species in nature has its own codon preferences. Obviously viruses like AGA, and do not like CGG at all, in nature.
But guess which species does use CGG for Arginine more than the other 5 competing codons - yes its jolly old homo sapiens. Our coding preferences for Arginine are
AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).
So the CGG codon in the furin cleavage site WILL have come about through Chimeric (human animal combination) gain of function research.
From our exhaustive patent searches we see that only Moderna and the University of Illinois and Ecopia Biosciences Inc were involved in human virus research using the double CGG Furin cleavage site. The University of Illinois was interested in the sequence APPA not PRRAR and they did not claim anything from the genome containing the double CGG coded PRRAR sequence. Ecopia Biosciences was making Enediyne rings which are not proteins, but are cancer torpedoes which can be delivered by viruses . Whereas we know the Moderna's research led to their mRNA vaccines against Covid19. So they are the only candidate doing research in precisely the right area. They filed their first patent containing the double CGG coded Furin Cleavage site on 2013December16 and they filed the last 5 patents citing the double CGG insert before the Covid19 pandemic began.
Furthermore of all the patents citing the insert, only the Moderna Patents match the entire 19 nucleotide sequence CTCCTCGGCGGGCACGTAG in Covid19. No other patents filed before Covid19 arrived have the entire 19 letter sequence.
Moderna cite 7 patents on their website at https://www.modernatx.com/patents
for their gene therapy mRNA-1273 (amino acid chain) vaccine...
US 10,703,789 filed January 12 2019
US 10,702,600 filed February 28 2020
US 10,577,403 filed June 12 2019
US 10,442,756 filed December 18 2017
US 10,266,485 filed June 11 2018
US 10,064,959 filed April 21 2017
US 9,868,692 filed July 27, 2017
The 2nd patent, filed on February 28 2020 was a continuation of an earlier patent application number 16/368,270 which was filed on March 28, 2019
So they had all 7 patents applied for by June12, 2019, which is quite impressive given that the WHO was only informed of a pneumonia type outbreak in Wuhan on December 31, 2019.
So all the patents needed to protect Moderna's particular vaccine monopoly were applied for 4 months before the outbreak of the disease that the vaccine is supposed to be curing in October in 10 hospitals according to Glenn Beck.
Nature has had certainly 100,000 years to make human viruses and it never once put a double CGG furin cleavage site into any virus. Yet within 6 years of Moderna referring to it in their patents, we find it in Covid-19 in circumstances where Moderna is working on a vaccine for that virus. So just there the probability is not 100,000 to 6 or 16,666 to 1 that Moderna is responsible rather than nature. No it is 100% because nature has not done it in a virus. It never has and there is no evidence that it ever will.
It is man that mixes up human and viral Arginine codons not nature.
US 10,703,789 Here is what the Patent claims: Claim1. A pharmaceutical composition comprising:
a plurality of lipid nanoparticles comprising a cationic lipid, a neutral lipid, a cholesterol, and a PEG (polyethylene glycol) lipid, wherein the plurality of lipid nanoparticles has a mean particle size of between 80 nm and 160 nm; and wherein the lipid nanoparticles comprise an mRNA encoding a polypeptide, wherein the mRNA comprises:
(i) at least one 5′-cap structure;
(ii) a 5′-UTR (UnTranslated Region);
(iii) an open reading frame encoding the polypeptide and consisting of nucleotides including N1-methyl-pseudouridine (fake Uracil), cytosine, adenine, and guanine;
(iv) a 3′-UTR; and
(v) a poly-A region of least 100 nucleotides in length.
Claim1 is basically the finished vaccine. So in October 2019, just 4 months after 2019June12 when they got the N1 Methyl Pseudouridine (fake Uracil) patent filed, 10 hospitals in Wuhan had Coronavrius cases according to Glenn Beck's documentary.
"We do know just about 12 months later in Wuhan – where Peter Daszak, Dr. Shi, the bat lady, and Dr Baric were all doing research on coronaviruses – about a year later, there’s an outbreak, and the outbreak actually begins according to documents that we have that have been smuggled out of China that there were 10 hospitals involved by October with patients that were now, we now know, are corona-like virus symptoms. They didn’t know what was going on. Now, that was in October". - Glenn Beck - https://thelibertydaily.com/glenn-beck-drops-bombshells-on-tucker-nih-claims-joint-ownership-of-moderna-vaxx-started-working-on-it-long-before-pandemic/
So the writer can confirm, and the reader can confirm using the links above, that Moderna did apply for a Patent on the reverse compliment of the double CGG coded 15 nucleotide Furin Cleavage Site in Covid-19 and actually on the 19 nucleotide sequence containing it as described above. Furthermore they did not merely apply for a patent on 2016 February 4 with US9587003B2: as reported in the Daily Mail. They actually applied on 2013 December 16 for 4 patents with US9149506B2, US9216205B2, US9255129B2, US9301993B2:as well.
So Moderna had developed the 19 nucleotide gene sequence containing the Furin Cleavage Site which gives Covid19 its infectivity to humans by patented gain of function research as early as 2013, 6 years before the Wuhan outbreak took place. Not 3 as reported in the Mail and virally elsewhere. But the bat coronavirus RaTG13 from which Covid19 was derived was also discovered in 2013. Well, what a coincidence!
The reason that the writer is so confident that Moderna or their agents made and leaked Covid-19 and the reason he called it as such at the start of the pandemic to almost as much ridicule as Prof Montagnier received (God bless him) is that the scriptures say in Matthew27, Mark15 and John19 that.
29 And they (the soldiers of the governor of verse 27)
platted a crown of thorns and put it upon his head, and a reed in his right hand; and they kneeled down before him, and mocked him, saying, Hail, King of the Jews!
30 And they spat upon him, and took the reed and smote him on the head. (Matthew 27 ASV)
May I therefore beg your indulgence whilst I interpret these words:
The US department of defence funded the gene splicing of the Coronavirus of Spike Proteins (Covid-19) through NIH and NIAID and DARPA which first infected Jesus, through his fiance, the New Covenant Saints, just after he became the secular King, Caesar to those saints, the antitypical Jews, those covenanted to be angelic sons of Jacob, the born agains angelically. We calculated that the malediction which prevented Jesus becoming Caesar to the saints ended in 2019Tishri15 (October17/18). Glenn Beck did a documentary showing that 10 hospitals in Wuhan took cases with Covid19 symptoms in October 2019. Yes Folks. Covid-19 is a proof that Jesus is now secular King over the saints, the antitypical Jews, the Jews by angelic salvation covenant, at the least - https://100percentfedup.com/bombshell-glenn-beck-reveals-nih-and-moderna-worked-on-mrna-vaxx-together-before-pandemic/ [Ed but only those who have died in their human bodies by Passover execution and been resurrected into the ark, that is the 1NCs and the HLCs of the 3rd Holy Spirit. He does not become Caesar to Abraham until 2022Chislev5 and Adam until 2022Chislev6 and Isaac until 2022Tebbeth5 and Cain until 2022Tebbeth11]
But then the soldiers spat upon him. For that is how Covid19 is transferred, through small aerosol droplets exhaled out of the mouth. The soldiers deliberately spat upon him. It was not a SALIVA LEAK! They smote Jesus on the head because the saints are the head of the church and they caught Covid19 not by random chance infection but by a deliberate smiting with a read, a biological weapon, a deliberate weaponised attack. For more on this see here.
So what Prof Montagnier saw with his virology expertise, I saw with my theological expertise. Showing that whilst fact checkers and science are mutually exclusive, science and theology actually agree, when properly understood (and that is one big caveat). Prof M taught us that the vaccines cause the variants. Indeed basic virology forbids mass vaccination during a pandemic for that very reason. He said the the curve of deaths follows the curve of vaccinations. Mind you, paradoxically, if the vaccines caused Omicron, then they saved us from themselves!
The Covid19 makers, the genetic vaccine makers. their funders and their promoters, which include almost every government and public sector and health service in the world, are therefore guilty of Genocide and crimes against humanity. They have pushed genetic rape and sickness and death onto half of the population of the world in order to enrich the pockets of Pharmaceutical Companies. Governments and Public sectors around the world have abandoned their health service regulation to billionaires and heartless corporations
In the UK, all of the income tax we pay goes to the health service and all of its protocols are determined by its regulators and all of its regulators are controlled and funded by Big Pharma who seek to damage then manage our health for their profit.
So every penny we spend in income tax brings us one step closer to sickness, to death and to drug dependency.
So why did Prof Montagnier choose to spend the last years of his life proving that Covid-19 was man made and that the spike proteins, and therefore the vaccines, were an existential threat to the species? What did he have left to prove to himself or to anybody else at 87-89 having won the Nobel Prize for discovering the HIV virus? He certainly did not do it to increase his reputation in the profession. No he was driven by the same passion that drove him to discover HIV. A passion to SAVE mankind from viruses and those who would engineer them to damage us. And why did he give up the ghost in February 2022? Because he knew that Omicron had the vaccines beat. His job was done by a greater virologist even than him. He could therefore rest in peace and go see some people who understood the magnitude of his contribution.
Covid-19 was not made in 2019. It was made from the 19 nucleotide Moderna specific chimeric (CGG for AGA) furin cleavage site which does not occur anywhere in nature.
And every Covid death and every Covid vaccine death is parked squarely on their doorstep waiting for justice.
But we shall not execute that justice fast enough and therefore the final plague upon mankind of Revelation 6:8, delivered by the 4th horseman of the apocalypse, which plague Bill Gates himself has prophesied, will arrive later this year (after War and after Famine, the 2nd and 3rd horsemen).
A certain professor from a UK Teaching Hospital wrote to me as follows
"You aught to read this from the Wikipedia article
Furin cleavage site
Some claims of bioengineering focus on the presence of two sequential cytosine-guanine-guanine (CGG) codons in the virus' RNA, more precisely in the crucial furin cleavage site.[9][74] The CGG codon is one of several codons that translates into an arginine amino acid, and it is the least common arginine codon in human pathogenic betacoronaviruses.[105] Partially, this lack of CGG codons in human pathogenic coronaviruses is due to natural selection: B-cells in the human body recognize areas on virus genomes where C and G are next to each other (so-called CpG islands).[15][106] The CGG codon makes up 5% of the arginine codons in the SARS-CoV-1 genome, and it makes up 3% of the arginine codons in the SARS-CoV-2 genome.[9] Proponents of an engineered virus, including journalist Nicholas Wade, claim that two such uncommon codons in a row are evidence for a laboratory experiment; because of the low chance of a CGG codon pair occurring in nature, and in contrast, the common usage of CGG codons for arginine in genetic engineering work.[9][74] This has been disputed by scientists, who note that the CGG codon is also present (and even more frequent) in other coronaviruses, including MERS-CoV,[107] and that a codon being rare does not mean it cannot be present. In addition, the presence of the furin cleavage site, which is responsible for a significant increase in transmissibility, largely outweighs the disadvantageous immune responses from B-cells triggered by the genetic sequences which code for it.[106][15]
You are unlikely to gain support from people who are actually involved in genetic engineering and evolutionary studies like myself.
I will delete this thread and block your email after sending.
xxx - not easily taken in - xxxxx "
So I looked up the paper by the plurality of "scientists" as opposed to the singular "journalist" Nicholas Wade - reference 107. And wrote the following response and checked that his email server did accept my email...
Dear Prof XXX,
Thanks for your email. If you can prove my reasoning wrong I would be happy to write a correction in my next article.
I read the one reference cited in Wikipedia for MERS-CoV having the CGG Codon and that paper states explicitly and emphatically...
"All human coronaviruses analyzed in this study did not use two synonymous codons (CGC, CGG) for arginine as well as CCG for proline and UGA for stop codon at all. " -
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7487440/
My argument is very simple.
No virus in nature uses the CGG codon for Arginine in a furin cleavage site. I did check that in the blast database. I did the search. Nothing came up.
Please therefore show me a naturally occurring virus (preferably one that appeared before Moderna appeared) with a furin cleavage site containing two CGG codons and you will defeat my argument.
I am afraid you were taken in XXX - not by me, but by Wikipedia !
Regards....
I got no response from the Professor. But strangely Wikipedia changed the reference number from 107 to 116 in the article above. Yet it still links to the same paper? So Wikipedia is falsely inferring that "scientists", as opposed to one lone journalist, dispute that there is a low chance of double CGG occurring in nature, by noting that the CGG codon occurs in MERS citing a paper which explicitly declares that none of the human coronaviruses analysed within it used a double CGG codon, No true scientist can dispute the low chance of a sequence occurring in viruses by analysing viruses in which said sequence does not occur. Wikipedia is providing disinformation which just happens to protect the interests of pharmaceutical companies
But all of this is - dare I say it - academic. Because there are absolutely no viruses which have a CGG doublet in a Furin Cleavage site (PRRAR) except Covid-19 and except plant viruses which Dow Agroscience. Monsanto, or the like, have modified. And whether you are a journalist or a cell biologist or both (like myself) or neither, this article gives you the tools to check that FACT for yourself.
https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/ Search for CCTCGGCGGGCACGT which codes for PRRAR,
The age of Hypersonic Nuclear Terrorism has begun. AKA The Great Tribulation of Matthew24. It began upon the last weekly Sabbath of Greek winter as Jesus predicted. This was Sunset Friday March18 to sunset Saturday.March19. 3:33 pm on Sunday March 20 is the vernal equinox, the start of Spring astronomically.
20 Keep praying that your flight may not occur of winter and not in the Sabbath (Matthew 24 LWT)
20 proseucesqe de ina mh genhtai h fugh umwn cimwnoj mhde sabbatw
(Matthew 24 SinaiO)
21 For then shall be Great Tribulation, such as was not since the beginning of the world to this time, no, nor ever shall be.
(Matthew 24 KJV)
21 este gar tote qliyij megalh oia ouk egeneto ap archj kosmou ewj tou nuҠoud ou mh genhte
(Matthew 24 SinaiO)
On: Saturday around 9:00am UK time, Russia announced that it had used the Kinzhal Hypersonic missile system on Deliatyn, a village in the foothills of the picturesque Carpathian mountains, outside the city of Ivano-Frankivsk, to take out an ammunition dump there. These missiles go at Mach 12 and are unstoppable by any NATO anti missile system.
"He could have used some other missile, and he chose a hypersonic one," she said. "So the strategic messaging is that they've got this weapon. We don't. But even more importantly, is because it's dual-capable – it can be loaded with a conventional warhead or with a nuclear warhead."
Koffler argued that using the Kinzhal missile loaded with a conventional warhead proved no more strategically useful for Russia than by using another long-range cruise or ballistic missile.
"He's messaging to us that he has a high tolerance for nuclear warfare," the former DIA officer said. "And that if pushed – if we continue pushing him in the corner – he will have no choice, in his view,
but to do this." -
Koffler said that while the threat of a nuclear strike has increased, she believes Moscow may have launched a hypersonic missile to "compel us to stand down."
"It's a game-changer in the geopolitical realm, not unlike in the military realm, because they're trying to [send a] strategic message," she said. "In my assessment, [Russian President Vladimir Putin] is climbing small steps in the escalation ladder on the trajectory to nuclear warfare." https://www.foxnews.com/politics/russia-claims-ukraine-hypersonic-missile-expert-warns-putins-strategic-plan
The public are not yet in great tribulation over the launch of one (now two actually) kinetic hypersonic missile. But as Rebekah Koffler points out. This firing was a military and geopolitical game changer.
Hypersonic missiles travel at least 5x faster than the speed of sound. They are so fast that they are invisible: “No one will see the missile launch or its flight. They will only see when the missile hits the target,” said Igor Krokhmal, the captain of a frigate that fired one.
The Russian Hypersonic Missile Arsenal
Kinzhal is a Mach12, 3000km range air launched nuclear capable missile.
Zircon is a Mach8 1500 km winged ship or ground launched antiship missile
Avangard is a Mach20 unlimited range ballistically launched manoeuvring glide vehicle MIRV nuclear weapon - WOOPS
Kh85 is a long range air launched hypersonic cruise missile - https://www.19fortyfive.com/2021/08/russias-hypersonic-weapons-arsenal-all-four-platforms-explained/
A Mach 12 missile goes at 12x the speed of sound which is 760 mph. So it goes at 760 miles per 5 minutes or 152 miles per minute or 2½ miles per second. So it is invisible, inaudible and unstoppable other than by another hypersonic missile, which missiles NATO does not possess. The writer was once offered a job at British Aerospace to calculate the probability of a Russian nuclear missile getting through UK defences to hit the mainland if the Russians fired X number of nuclear missiles and we responded with Y number of anti missile missiles. I did not accept that kind offer, reasoning that either my entire working life would be a waste of time (hopefully) or, I would be obliterated.
However I am happy to report, that I can now perform that calculation for British Aerospace and indeed for the MOD itself. In fact due to my boundless generosity I will even do it for free. The probability of the UK mainland being hit if Russia fires ONE hypersonic nuclear missile at us is 100% because we do not have any hypersonic anti missiles.
Mutually Assured Destruction No Longer Exists
The principle of MAD, Mutually Assured Destruction, requires a balance of terminally offensive capabilities. The principle aims to ensure that if either side starts something the damage will be mutual. In other words any nuclear strike is suicide.
That principle no longer exists because Russia deployed its S500 hypersonic anti ICBM missile system in September 2021...
"Currently, no country has publicly demonstrated its ability to counter hypersonic missiles. However, the Russian Aerospace Forces have assured that the S-500 missile defense system will be able to intercept and destroy hypersonic targets, according to Sputnik. The S-500 has been in service with the Russian army since September 2021." - https://militarycognizance.com/2022/03/15/what-missile-does-the-us-currently-have-to-counter-hypersonic-weapons/
So the Russians have an offensive hypersonic nuclear weapon for which NATO has no shield. And a defensive hypersonic shield which will easily stop a non hypersonic ICBM and also stop a hypersonic missile should NATO ever possess one.
Hypersonic Conventional Warfare
But as regards conventional war, NATO may have already lost. NATO is more powerful than Russia conventionally. But it has no hypersonic missiles. So that advantage will be short lived if Russia has several hundred of them. And it has already fired two at Ukraine.
The UK has two brand new really expensive aircraft carriers, the HMS Queen Elizabeth and the HMS Prince of Wales. These carry the Lockheed Martin F35B Swiss penknife jet, the contract for which destroyed McDonnell Douglas, by limiting US air force jet production to one jet and one contractor (Lockheed Martin). this was very good for the shareholders in Lockheed Martin and Boeing. But disastrous for the flexibility of US military research, design and supply.
The purpose of a UK battle fleet is to protect these aircraft carriers which project the power of the F35B.
Neither aircraft carrier has any defence against the kinetic shock wave generated by a mach 12 hypersonic missile impact. These missiles were actually designed by the Russians to take out US and UK aircraft carriers.
"The U.S. military should consider buying a huge arsenal of long-range, hypersonic missiles instead of trying to maintain a large fleet of nuclear-powered aircraft carriers." That’s one idea that Mike Griffin, the undersecretary of defense for research and engineering, proposed at a Washington, D.C. conference in September 2019. - https://nationalinterest.org/blog/reboot/hypersonic-missiles-not-aircraft-carriers-are-best-military-weapon-199710
The US is budgeting in 2022 to develop a potential defence against hypersonic missiles. It presently does not have such a defence - https://news.usni.org/2021/06/14/mda-u-s-aircraft-carriers-now-at-risk-from-hypersonic-missiles
So these two Jewels in the Crown of the British Navy are already sunk.
Serious Advice for the Royal Navy to Implement Today (not after a 4 year feasibility study with associated medal awarding ceremonies for all concerned)
1. Take all the F35Bs off the 2 aircraft carriers and put them all in Hypersonic missile proof bunkers in the UK and in the Countries which do not have a buffer zone with Russia. Put marine fish tanks in the bunkers if it makes you feel more at home!
2. Build Zircon proof bunkers for all missile firing frigates and destroyers and put them in those bunkers. Provide the bunkers with a roof window through which to fire the missiles (like in a submarine)
3. Build Zircon proof bunkers for the two carriers and fit them with some kind of hypersonic missile shield above the flight deck. That will require giving the kind of power, resources and prestige to engineers (you know - spanner twisters)
that is normally reserved for our 13 rear admirals. You need to find some Elon Musks, pronto.
4. Every ship in the Navy of any military significance must have enough liferafts for all of its crew AND for its removable nigh value military assets.
As of 9:00 am Saturday March19, the Royal Navy as it stands is obsolete. But it is not yet sunk. You have a few weeks to reimagine it before Putin gives all sea going naval crews the Order of the Bath.
Britain was the first country that landed a plane on a ship. We did it in typical British Naval fashion: The ship was sailed straight into a very strong wind, the plane was asked to fly as slowly as possible above the ship as close as it could to the deck. Then a crowd of seamen were instructed to 'Catch the plane' with their hands - which they duly did..
Now I am recommending that we become the first country to reverse that process and remove the jets from our 2 aircraft carriers.
The bottom line
In American parlance: Putin is a gunslinger with a gun which can fire instantly and which will pierce the bullet proof vest of Boris. Boris has a gun that takes 30 seconds to fire and may or may not pierce the bullet proof vest of Putin. So who will win the gunfight?
In Irish parlance: Boris has a bomb under his backside and Putin has the trigger. Whereas Boris has the capability to throw a bomb at Putin which may or may not hit him. Who will get blown up first?
The MOD is not fit for purpose
Putin has effectively been the president of Russia since 2000. From a standing start with a broken economy and an obsolete but practical military, and with a very limited budget (in military terms) he has overtaken the West and NATO definitively. He has done a better job for the Russian military and the Russian economy in this century than Hitler did for Germany in the last century. He has personally presided over a military superiority which was unthinkable when he first took office. He has also been as ruthless as Hitler with many of his adversaries
Putin has transformed his military at hypersonic speed. A speed which we have failed to match except perhaps in the scaling back of our armed forces. Our present philosophy for fighter aircraft appears to be to wait for the Americans to build something and then buy it at a greater cost than would have been incurred by designing and building it ourselves. It is this lazy reckless profligate and subordinating policy that has lead us to the present military catastrophe, wherein MAD has evaporated and Putin has a sword for which we have no shield and a shield for a sword which we are yet to build.
In short he is at least two steps ahead of us in this chess game. We are sitting ducks for his missiles and our military intelligence, armed forces and MOD have never failed us more spectacularly than they did on Friday/Saturday March18/19. But was it a failure or was is deliberate?
Because I write this article as a Patriotic Brit, who knows our armed forces to be the most effective and professional and well trained and least trigger happy in the entire world, and who still clings naively to the notion that our government are likewise patriotic Brits. But this is the age of globalism. And our real enemy is not only Putin with his instant destruction devices. It is those whom both he and our own corrupt government are in league with, the globalist demons of the great reset. For before they can build back better, they have to destroy what is presently built. And there is no more effective destruction mechanism than war.
I have nothing but admiration for the men and women of our armed services (except when they kill innocent civilians). So I hate to see them compromised, as they so often are, by a self serving and corrupt MOD. It is corporate corruption and greed on both sides of the Atlantic and WEF globalist influence which has destroyed our military capability with woke ideology, with toxic femininity, with alphabetology (the debilitating intrusion of sexual preference as some kind of major priority into every military protocol), with critical race theory, with political correctness, with years of under investment, with the scrapping of entire regiments for reasons of "cost cutting"; and with our retirement from the hypersonic arms race in circumstances where we invented the scramjet upon which hypersonic missiles are based. How can the nation which invented the jump jet and Concorde, have nothing to compete with Kinzhal and Zircon? At least the Russians had Concordski!
If we get into a fight with Putin, I fear we will lose that fight. Not so much because he has the military advantage through his invisible unstoppable and invincible hypersonic weapons, but because even though we have commanders smart enough to find a way around anything, to match his every chess move, they will not be encouraged or permitted to do so by the globalists who have infiltrated our establishment. Or putting this more positively. If we wish to win WW3, we have to recognise who all of our enemies are. both without and within, both foreign and globalist and domestic. For the most dangerous and damaging enemy is the one who poses as your friend and the most dangerous killer is the one who poses as your saviour (Dr Death Fauci). We need a commission set up immediately to investigate and remove all WEF types from public office. For what they have done to the NHS with their controlling profit driven protocols, they will also have done and be doing wholesale to the MOD.
The British are a very ingenious and creative race. The control of the MOD necessary to stop us from competing in the hypersonic missile race will be substantial. We may only have weeks to fix that before we are competing against the very missiles we refused to develop, which run on the very engines that we invented.
Plainly speaking. Whilst we should be sanctioning the Russian economy, in order not to fund their war effort and make even more refugees, we should not be sanctioning and evicting Russian Oligarchs. Because that is theft. Having a warmongering Russian president does not entitle anyone to steal the money or the assets of ordinary Russian citizens, however rich they may be and wherever they may happen to be domiciled. For if it did, then the Russians could have taken our money under Blair and Americans' money under Bush. But our government for all its woke posturing, is devoid of morality. It is self exposed as a common thief. Also we may need the Oligarchs to help deal with or remove Putin. What we should be doing is evicting all WEF trained globalists and their groupies from public office and from political positions in the private sector- because they are enemies to the state and to the people and to democracy itself.
Putin's Legacy
Putin's political life's work has been the establishment of Russia as the pre-eminent world military force. He has now achieved that goal. His window of hypersonic superiority will be closed in 2023 according to US Defence secretary Mark Esper. The incompetence of the non Biden administration in Afghanistan, may well be reversed if and when Trump is returned to office either in a few weeks or in 2¾ years depending upon what the Durham investigation has found. Putin is now 69 years old. What will he do with his life's work in this window that he presently has? What really was behind his successful drive to make Russia the top dog militarily? This is the argument that the mainstream media is presently having with much of the alternative media, who regrettably are turning into a reverse echo chamber for the MSM on this issue. Will he invade Latvia, Estonia and Lithuania with a battle plan not dissimilar to the one screened on Russian State TV last week? Or will he settle for part or all of Ukraine? How ambitious is he?
I am afraid that is the wrong question. How ambitious are the globalists? is the right question. And the answer is. Well, of course, being globalists, their ambition is global. It is not limited to Ukraine.
Putin and Klaus Schwab go way back having first met in 1992, 8 years before Putin became president - https://www.thelibertybeacon.com/putin-and-the-wef-cause-for-concern-are-we-being-played-yet-again/ .
Vladimir Putin: And when can a vaccine for children appear already in civilian circulation? Will there be registration now, but when will it go into civil circulation?
Tatyana Golikova [Deputy Prime Minister - Sounds like it too!]: I think that with a favorable outcome it will be the end of December.
Vladimir Putin: Good… As the experts told me, in some other countries, in particular in the People's Republic of China, they have already begun to work on a vaccine for children from the age of TWO, right?
Tatyana Golikova: So, Mr. President…
Vladimir Putin: We also need to think about this. I repeat once again: in general, in general, I believe that vaccinations should be voluntary, especially for children.
https://edwardslavsquat.substack.com/p/russia-to-start-injecting-kids-with
Any world leader who advocate vaccinating 2 year olds against Covid19 is a globalist, however voluntary he represents his vaccination program to be.
But that then leads to the critical question that writing this article has enabled me to formulate.
Why did Russia not cite the 12+/26/32 US run Hunter Biden negotiated Biolabs as their reason for invasion?
They cited denazification. They cited their supposed need for a buffer zone from a NATO which is not prepared to engage them. They cited the security of the Russian speaking people of Donetsk and Lugansk which security was negatively impacted by the Russian 2014 invasion of Crimea and parts of those Donbass provinces. They cited a faux history lesson implying that Ukraine never has been a separate country from Russia and by implication does not today deserve to be one. None of these come close to justifying an invasion of a sovereign nation, especially when the Russians had already invaded the same sovereign nation in 2014 more on the pretext that the majority of the inhabitants of those parts were ethnically Russian, which is again a non justification. Just because they are ethnically Russian does NOT mean they want Putin as their president. Romania could invade most of London on that pretext and we could invade Germany.
My personal belief is that since any man or woman can divorce their partner on any grounds these days, so any part of a country which seeks independence should be given that divorce. Perhaps we should come up with an international divorce court for that very purpose? I would include Palestine, the Kurds, the Basques, the Scots, Hong Kong, Taiwan etc in that category. The more national cells that the body of mankind has the better in my opinion. Trouble arises when one man controls too many people. That is one reason I was against the EU. The more power there is in one person's hands, and the longer he has it, the more dangerous the world becomes. In fact right now the battle is on, in fact the war is on, to determine which person or group of persons becomes ruler of the entire planet, which is the worst possible apportionment of political power for mankind.
But if any area of Russia sought independence from Putin they would be brutally put down, even if it meant bombing them back into the stone age as was the case with the Chechen separatist struggle. My opinion is give them a vote and let them decide for themselves. Bombs should decide nothing- however fast they can travel.
But what is beginning to annoy me the most is the tribalism that is developing between the Main Stream Media and the Alternative media, which is beginning to resemble the Democrat Republican divide in the US. I will not have my thinking bashed into the MSM paradigm and neither will I have it bashed into the fast emerging and equally unpalatable Alternative Media paradigm which is that every bad thing that Putin does is the fault of the West or is justified because the West has done worse. Just as I lean to Trump in US politics but take Al Gore's position on Global warming and loved visiting America under Clinton but hated the place under the 911 phobia of Bush. Yes I know the globalists will use global warming for their nefarious reasons because that is what politicians do. But that does not mean ocean temperatures are not rising. I write for the expose because they are the most Voltairean news source, I have yet had the good fortune to discover. Yes folks. One can be alternative even to the alternative media!
The FSB absolutely knew that there were 12+/26/32 biolabs in Ukraine. Izvestia covered 8 of them in an article dated 2020May26:
American biological laboratories have been discovered in Ukraine, which contain samples of especially dangerous infections to "prevent the development of bioweapons," Ukrainian News writes on Tuesday, May 26, citing data from the country's Ministry of Health.
8 laboratories based on regional laboratory centers were built and modernized with the participation of the US Defense Special Weapons Agency (DTRA) as part of the Special Biological Engagement Program between 2005 and 2014. Laboratories were built in Vinnitsa, Dnipropetrovsk, Transcarpathian, Lvov, Kharkiv, Kherson, Ternopil regions, as well as on the basis of the republican laboratory center of the Autonomous Republic of Crimea.
The Expose covered this on March 9th and subsequently: https://dailyexpose.uk/2022/03/09/russia-to-the-u-s-we-have-found-your-biological-weapons/
Yahoo has a good history of the story and the attempted coverup.
But the biggest coverup of them all was the failure to justify the invasion with the invasion justifying biolab cause. Had they adduced that as the reason for invading the country, especially as these labs may have been working on ethnically specific pathogens, they would have had a very good case for invasion. A case as valid as the Cuban missile crisis. How could that history lesson have gone missing on Putin. Really?
I suspect that Putin did not adduce that valid justification because first of all that was not the reason he invaded and secondly because his handlers have sold out to the globalists and they did not want to bring further attention to the existence of these labs. Sure they will use them to score points politically. But I predict that there will be no revelations as to the the true nature of their work from Russia. Also the US trust the Russians in this regard or they would have demolished those labs more speedily. Putin did say to Megyn Kelly in 2018 although I cannot now find it on the web, that when you become president of any country, a bunch of men in suits appear and tell you what you can or cannot do - or words to that effect - I was quite amazed at his candour. I think he liked Megyn. I have rarely seen him smile at all. But for her he managed some broad smiles. He was referring to the latitude that Trump had at the time. But being KGB/FSB himself, he knows the rules. His handlers are globalist.
I cannot forget that according to Max Blumenthal and Jimmy Dore (14:15 into the video), Yeltsin got the OK from Clinton before he rigged Putin's first presidential election against Nemtsov whom Putin most likely had assassinated in 2015 outside the Kremlin. He was shot in the back by a Chechen Assassin whilst having dinner with his Ukrainian girlfriend. The world would have been a very different place had Clinton chosen Nemtsov. Clinton is a globalist of course. Yes. Rather than the Russians interfering in American elections as charged by Democrats, the Democrats directed the determinative electoral interference that gave Russia to Putin these last 22 years.
So let me attempt to tie this all together. WW3 is the means for enforcing the Mark of the Beast, which is the Chinese style social credit score linked vaccine passport system. The globalists need martial law in order to achieve their sick unsustainable goal of controlling all of mankind and enforcing a brainwashed conformity upon us through the new global reset digital currency, the image of the Beast. Now if you refuse to bow down before that image you will be thrown into the fiery furnace of WW3, by which is meant you will be cut off from all protection shelters and from all war time rations etc. But none of that can occur without WW3. So WW3, the ride of the 2nd horseman of the apocalypse, will have to occur. Now that does NOT mean that WW3 is Russia's fault necessarily. Both sides are capable of false flag events.. WW3 will be the globalist's fault. They want the war. They need the war. They will corrupt manipulate and leverage what is happening in Ukraine to cause it. Putin is normally pretty surgical. He may not want WW3. But that may well be irrelevant. Because in war you rarely get what you want. You normally lose what you want. And those who control the money, the globalists, do want WW3.
Bush 43
If you read the Megyn Kelly 2018 Putin Interview, which I absolutely recommend, you will see that these hypersonics came into existence not merely due to the brilliance of Russian weapons designers but actually due to the arrogance, warmongering incompetence and heartless myopic incuriosity of the neo cons in the Bush 43 administration, who pulled out of the ABM treaty because they believed that they had the capability to build effective anti nuclear missile systems whereas the Russian economy was so defunct that they had no capability to respond with such systems. Putin made the same calculation and therefore at that time was ready for a full compromise and offered to work together with the US with full disclosure to keep the balance even.
Putin's post 911 idea was that rather than the Russians and the US trying to out nuclearize each other, they should cooperate strategically and combine forces against radical Islam and other terrorists. That was indeed in their common interest as both of their independent episodes in Afghanistan demonstrate. But Bush43 who handed his administration over to the Neocon globalists and went off to play golf instead of running the country, rejected the most important strategic partnership offer of the 21st century.
Putin, being unable to afford better anti missile defences, decided instead to make a missile for which there could be no defence. Since that was all he could afford to do. He never would have made these hypersonics if Bush43 had had any depth to his character or his thinking. But of course he was chosen precisely because he did not have that depth. He was another puppet like Biden. Most likely to the same intelligence service handlers.
A Biblical Perspective (if you are interested)
It seems, in this world, that behind every master manipulator, there is an even more masterful manipulator. And behind every conspiracy, there is an even greater conspiracy. But the greatest theory of them all must offer an explanation for all those biolabs in Ukraine. These surely must be to do with the 4th horseman of the apocalypse, who has the charming name of death, and who rides a chlorine coloured horse. Mustard gas was the first WMD ever used in a World War. Whatever they were making in Ukraine, looks like being the last WMD to be used in a World War, the plague of Revelation 6:8.
That was the bad news. The good news is this. For those of us who are awake, the apocalypse precedes the war and carries on progressively throughout the war.. Indeed the war is the demonic response to the apocalypse. That is how close it is. For the first horseman, who starts the uncovering of all deception, rides before the 2nd horseman, who is war. So to misquote the famous phrase: It will get worse as it gets better.
Without going into detail, the 10 horns who are 10 kings of Revelation17 have now given their power and authority to the globalist beast (represented by the WEF). Russia is one of those horns (military powers) as is the UK. That is why I say it does not matter what Putin's ambitions are. He or his handlers have sold out as have we. He is a direct or indirect traitor to the Russian people just as Boris is to the British people. Both may be trying to do some good in a bad environment. But they are both now first lieutenants to Satan through the beast (the global corporate shadow government). That is what makes them bad. They or their handlers have both committed treason with our sovereignty already. This makes the war almost completely meaningless from a nationalist standpoint. I do not know their motivation. I do not know if they are possessed. But we shall know very soon as a part of the apocalypse.
We predicted on February25, on twitter, from Matthew 24:20 that the Great Tribulation would start on 2021VeAdar10 (2022March18/19). Because it was the last Sabbath of Greek Winter, which was also not a Sabbath by virtue of the Biblical lunar calendar treating 2021Adar10 and 2021VeAdar10 as the same day. We got that one right with the first successful war time use of a Hypersonic missile. We have got it wrong hundreds of times previously. But decoding is an iterative process and we are getting a bit better at it now. We predict the Great Tribulation to be 96 Biblical Lunar Calendar days (90 Gregorian days) long. So it ends on 2022Sivan16 (2022June16/17), which is the appointment of the Kingdom of God over its citizens. It is also the end of all nuclear war, but not the end of all conventional war. That ends on 2022Tishri29, which is 2022October27/28 and was John Lennon's dream, and the prophecy of Isaiah 2 that we shall beat our swords into ploughshares and the prophecy of Psalm 46, that God will break our arrows, cut our spears in two and burn our chariots. and we shall be glad beyond words when he does it. For this business of remote killing has gone on long enough and has now reached its inevitable conclusion with a missile which hits the target before it is launched in temporal terms, if fired Westwards (being several times faster than Concorde)..
WW3 lasts for 7 lunar months, because the fiery furnace of Daniel3 was heated up for 7x, a month for a time. So it starts on 2021VeAdar29 (2022April6/7) due to a false flag event in the UK or in the US (probably the US). There is an earlier false flag event in the UK (or the US) on 2022March28-31). Both of these false flags produce a mushroom cloud over the sea of 1Kings18:43. We have been predicting them as the 2nd and 3rd fire signs of 1Kings18 for 17 years totally unsuccessfully. We have got it wrong something like 700 times. But there again Windows7 took 7000 builds before Microsoft got that encoding right. So we have taken 700 before we may have got our decoding right. Recently some secular experts predicted a possible nuclear warning shot over the North Sea...
Experts warn Putin could drop a nuclear ‘tactical‘ weapon over ‘the North Sea’ in a show of force
written by Mark Fitt Political Journalist 1st Mar 22 4:45 pm-
Experts are warning that Vladimir Putin could use a nuclear “tactical” device at sea between the UK and Denmark.
Patrick Bury a lecturer in Defence and Strategic Studies at the University of Bath, told the New Scientist there’s around a 20% chance that Putin’s warning over Ukraine will almost certainly lead to an actual nuclear detonation.
Bury added the Russian President is likely to use a small “tactical” nuclear weapon against Ukrainian troops or detonate a larger nuclear bomb out at sea.
Pavel Felgenhauer, a defence analyst based in Moscow, echoed the warning as he told the Scottish Press and Journal, “An option is to explode a nuclear weapon somewhere over the North Sea between Britain and Denmark and see what happens.
That could well be a setup for the UK false flag. We were 17 years ahead of that game predicting a mushroom cloud above the Hudson in Manhattan and above the Thames around Dartford first in 2005 and wasting a load of money with expensive adverts in Newspapers at that time. In fact I effectively bet the Lords Witnesses church on that prophecy 700x and lost each time.
42 And Ahab proceeded to go up to eat and drink. As for Elijah, he went up to the top of Carmel and began bending to the earth and keeping his face put between his knees.
43 Then he said to his attendant: Go up, please. Look in the direction of the sea. So he went up and looked and then said: There is nothing at all. And he went on to say, Go back 7 times.
44 And it came about at the 7th that he got to say: Look!
There is a small cloud like a man's palm ascending from the sea. He now said: Go up, say to Ahab, 'Hitch up! And go down that the downpour may not detain you!'
(1 Kings 18)
The small cloud is like a man's palm, because it is man made. It is an explosive mushroom cloud because Elijah is doing a mushroom when he instructs his attendant to look for the cloud, by sticking his head between his knees. He is also kissing his backside goodbye because the bomb may be nuclear.
So here is my best secular-sacred interpretation. Putin does not want WW3, He just wants Ukraine. He would like his legacy to be not merely a rebuilt economy and a rebuilt military but also a reappropriated Ukraine. But these two mushroom cloud above sea fire signs of 1Kings18, which are the false flag fire signs from heaven of Revelation13, are designed to force NATO to attack him, which will force him to respond. He is warning us not to attack him by using a first and a second hypersonic missile. With Putin, words mean little, actions mean everything. He said as much to Megyn Kelly in March 2018
Vladimir Putin: It is important not to project strength, but to show it. It is also important how we understand power. It does not mean banging the table with a fist or yelling. I think power has several dimensions. Firstly, one should be confident that he is doing the right thing. Secondly, he must be ready to go all the way to achieve the goals.
However the Ukrainians outside of Donetsk, Lugansk and Crimea do not want what Putin wants. And nobody knows what these 3 ribs from the body of Ukraine in the mouth of the bear want because they are between its teeth (the Russian military) in Daniel 7:5. In fact the Russian military is divided over these 3 ribs of Ukraine. And like the rest of Russia, public opinion is suppressed in favour of state opinion. Although the 3 ribs do say to the bear: Get up eat much flesh. So they do want the bear to assimilate much of Ukraine. The lion is the UK, the Eagle is the US, the Bear is Russia, the 4 headed Leopard is China, South Africa, India, Brazil, the rest of the BRICS nations, which are all refusing to condemn the Russian invasion. The final 4th terrible beast of Daniel7 is the WEF globalist shadow government. The 10 horns of Daniel 7:7 are the 10 horns who are 10 kings of Revelation 17 (the UN Security Council Permanent members + the BRICS, nations + Germany + ??) , and the little horn is the EU.
Divine law is that God is not to be mocked, whatever a man sows, this he shall also reap (the spiritual version of Newton's 3rd law that action and reaction are equal and opposite). If Putin thinks he can get away (before God) with destroying Ukraine in order to increase the security of Russia, he is totally mistaken. Likewise if the Brits and Americans think we can get away with destroying the security of Iraq, we are mistaken. And if the globalists think they can get away with conquering the world by deception, they are likewise mistaken. We all reap what we sow. The trouble is, there may not be much time left in which to reap it. So justice will be almost instant, these days.
So my advice to all parties would be. Do not fall for the false flags. See them for what they are. Do not start WW3 because of them. My advice is that Russia does not want WW3 and NATO does not want WW3, but the globalist money people do want WW3. Be aware that having a large amount of money to spend is completely useless if you have no time left in which to spend it. And financial security is completely useless in the presence of hypersonic nuclear insecurity. Because a proximal nuclear strike will really mess up your ability to receive or spend your capital or your pension.
Vladimir Putin2
Here I am complaining about Biden and Bush43 being puppets and ignoring the scriptural reality that all the 10 Kings of Revelation 17, the 10 horns of Daniel 7, the 10 deep state administrations who run the globalist administration that we are now under, will also not so much be puppets but actually be possessed by demons at various levels. The wonderfully named Condoleezza Rice said recently that Putin is acting out of character compared to the person she knew. It is highly likely that he is demon possessed. In which case all bets about his past character are off. This leads me to my next conclusion - which was actually my first conclusion which I arrived at from my understanding of how total control freaks work. It is this.
The coming false flags designed to force the UK and the US into WW3 with Putin, may occur not because Putin does not want WW3. But because he does not want WW3 until he has conquered Ukraine and the Ukrainians are putting up a much better defence than he imagined they would. So Putin is not ready for WW3, but the globalists need it now due to their ghastly pathogen release and gene corrupting vaccination response program. If this is true then we should attempt to stop Putin in Ukraine militarily when he does not want us to. Rather than waiting for when he is ready to fight us. Because he is never going to stop until he is stopped.
But surely the original Putin would not have underestimated the reaction of his Ukrainian brothers so disastrously? His calculations were normally pretty accurate. This new Putin, Putin2 shall we call him? is nothing like the guy who put on a cowboy shirt and proposed a level of cooperation with the US that might have eradicated both radical islamic terrorism and the nuclear arms race.
Let me be very clear. Putin2 says if any NATO country officially defends Ukraine that will mean WW3. That may well be a lie. If NATO successfully defends Ukraine and Putin2 is not prepared to start WW3 until he has conquered Ukraine, then defending Ukraine will prevent WW3. I am not advocating attacking Russian assets outside of Ukraine. But if he brings in Syrians and Belarussians without causing WW3, he cannot logically object to the Ukraine bringing in a few pals of its own without causing WW3. There would need to be clear rules of engagement. Also the longer he has before WW3 breaks out, the more unstoppable hypersonic missiles he can make.
But in war, the rules of engagement book often goes out of the window fairly early on in the proceedings. In a conventional war, one Russian submarine or guided missile firing frigate in the North sea could hit any target in the UK fairly quickly and Putin's longer range hypersonics could do that same thing from Russia .Whereas we would need a very large number of such platforms all around Russia to achieve the same thing and they will not work if he has substantial S500 hypersonic defences around the targets we choose. The only platforms we have which are protected against hypersonics are submarines or covert ops people.
Going nuclear is no longer even an option because we would lose in 2-3 minutes, the time it takes a hypersonic missile to reach London from a Russian submarine in the North Sea..
So here is my last conclusion (for today anyway). It would be extremely difficult for the UK to beat Putin even if we joined the war today before he is ready to take us on. Our military would need brilliant leadership and almost supernatural military personnel and special forces. Our armed services have been cut and emaciated to such a degree that we would be asking far too much of them. I fear we have already gone one services cut too far. And the MOD has already lost the war to wokeism and failed to protect our military from gene corrupting vaccination. So I am afraid I just cannot see this working. Furthermore even if we did by some miracle defeat Putin in a conventional war, such a victory would lead to him going nuclear and we would then lose absolutely everything..
So actually the better our armed forces would perform, the closer to hypersonic nuclear annihilation we would come.
War with Russia is a no win situation, if they are prepared to go all the way. And Putin1 stated to Megyn Kelly that he was prepared to go that far and Putin2 will most definitely be similarly prepared.
THERE IS THEREFORE NO WAR SCENARIO I CAN SEE THAT WORKS FOR THE UK.
It is quite ironic that Bush43, the war criminal that Blair conspired with, is responsible for motivating Russia to out class the UK military completely.
I am afraid that in the game of warfare, Putin is as close to checkmate as you ever get. I am afraid he knows it. And I am afraid that he is demon possessed. The only way we survive this is by refusing war and the only way we win this is through the power of the heart of the Russian people - whom our government is busy demonising. One of them recently said upon leaving his homeland: I do not want to be part of a larger North Korea. I doubt that many Russians do.
The West has conquered the heart of the Russians, who have become very westernised and that is not going to go away. They have had a taste of Western style freedom as have the people of Ukraine. Indeed they are giving up their lives for it every single day. We must learn from their sacrifice. Putin must be defeated. But not by conventional or nuclear military warfare means. Not by a military war, but by the unstoppable invincible hyperemotive weapon of individual freedom, rather than slavery to the state which is slavery to the globalists above the state..
We must show the Russian people that we do not want to kill them in a war. We just want both them and ourselves to be free. Because that is what they want too. The globalist intelligence people who control facebook, youtube and twitter are now permitting hate speech targeting Russians. because they recognise this weakness in their defences. Do not fall for it. Putin does not represent the Russian people. He represents the globalists.
Hypersonic nuclear weapons do actually make war obsolete. The wise nation will realise that and not therefore engage in conventional war and therefore provide no pretext for the use of such doomsday devices. But that does not mean such a nation will not fight. We should fight for freedom and the truth. We should fight for the hearts of the Russian people not demonise them. We should do everything possible to help them remove him and we should work together to help each other remove all the other globalists and warmongers. And the best place to start that fight would have been through the Russian Oligarchs whom we stole from and demonised. There will be another Nemtsov (maybe Navalny). We must help the Russian people to empower him.
Putin has won the battle militarily. Our job is to make sure he loses the battle politically, by supporting those in Russia who understand that having a faster gun does not give you the right to rule over another nation (although through much of human history it has). We will not achieve that by demonising Russians. Putin is already demonised and inhuman. We have to expose that to the humans in Russia whom he claims to represent.
These people like Yoko Ono, Bobby Brown, Bill Gates, Klaus Schwab, Tony Fauci, Chris Whitty, or Vlad the hypersonic Impaler, who in my estimation put their personal advancement above the happiness of millions of other people, need to be exposed. Then the human heart and God's spirit will do the rest. And I personally cannot wait until they reap what they have sown.
There is a surprising biblical confirmation that Putin is acting on globalist instructions in his invasion of Ukraine which was perfectly timed to distract from the failure of the vaccines and from the Revelation that Moderna holds 5 patents on the one principle difference between Covid-19 and Bat Coronavirus RaTG13, which was discovered in the very same year (2013) that Moderna filed its first patent disclosing the double CGG codon furin cleavage site PRRAR. and that is Daniel 7:5 which says...
5 And, see there! beast, other second [it was], being-like/resembling/similar to a she-bear [Mother Russia]. And to one side it was raised up [It is raised up against the West but not against the East. Its hypersonic missiles raise it up above NATO in military capability] and there were 3 ribs in her mouth [The Donetsk, the Lugansk and the Crimean ribs of Ukraine. A rib is what remains over after the flesh has been licked off and consumed. Israel consisted of 12 ribs which are 12 tribes, but also 12 administrative regions of the country. These are 3 administrative regions of the Ukraine which have now been occupied by Russian forces and are therefore in the mouth of the Russian bear - dividing its teeth, its military as to what should be done next] [they were] between/separation of/separating teeth of her; and rightly/like this they were saying to her, 'Get up, eat much flesh
So it is NOT the Russian bear's idea to get up eat much flesh beyond the 3 ribs, the 3 provinces (Ukraine has 26 provinces, 26 ribs). The bear is TOLD to do that both by the ribs actually who wish it to conquer the rest of Ukraine (not by the teeth - the Russian military - who are a divided over the issue of the ribs, not really wanting to kill their Ukrainian brothers and sisters and children) and by the Globalists. Because Putin does not answer to Donetsk or Crimea. He answers to the WEF.
Having heard Ukrainian parliament member Kiera Rudik saying on Foxnews that every single minute a no fly zone fails to be enforced, some Ukrainian civilian pays for that minute with their life. A slight exaggeration perhaps but qualitatively accurate. I therefore think we should make a distinction between direct military intervention and humanitarian intervention. I think we should enforce a no fly zone to stop Putin bombing cities as best as we can - https://video.foxnews.com/v/6301955847001#sp=show-clips
This list is only of adverse events which were of special interest to Pfizer. And only covers the first two months of the vaccination campaign to 2021February28. Two obvious omissions are Shingles and Mononucleosis susceptibility.
The FDA wanted these Pfizer documents sealed until 2097. But the court ruled that they should be released at 55,000 pages per month. Here is some of what was released on March 1.
“This is a bombshell,” said Children’s Health Defense (CHD) president and general counsel Mary Holland. “At least now we know why the FDA and Pfizer wanted to keep this data under wraps for 75 years. These findings should put an immediate end to the Pfizer COVID vaccines. The potential for serious harm is very clear, and those injured by the vaccines are prohibited from suing Pfizer for damages.”-
https://christianresearchnetwork.org/2022/03/05/pfizer-reluctantly-releases-data-under-court-order/
We were told that the vaccines are perfect safe whilst all along the FDA had this list.
We were told the vaccines are not gene therapy when the first item in the list is a deletion of part of your DNA.
The FDA, by hiding this data. Denied the public any chance at giving an informed consent and defeated the very purpose for which the VAERS database was set up.
CONFIDENTIAL APPENDIX 1. LIST OF ADVERSE EVENTS OF SPECIAL INTEREST
1p36 deletion syndrome - THE PFIZER mRNA VACCINE ALTERS YOUR DNA
2-Hydroxyglutaric aciduria
5'nucleotidase increased
Acoustic neuritis
Acquired C1 inhibitor deficiency
Acquired epidermolysis bullosa
Acquired epileptic aphasia
Acute cutaneous lupus erythematosus
Acute disseminated encephalomyelitis
Acute encephalitis with refractory, repetitive partial seizures
Acute febrile neutrophilic dermatosis
Acute flaccid myelitis
Acute haemorrhagic leukoencephalitis
Acute haemorrhagic oedema of infancy
Acute kidney injury
Acute macular outer retinopathy
Acute motor axonal neuropathy
Acute motor-sensory axonal neuropathy
Acute myocardial infarction
Acute respiratory distress syndrome
Acute respiratory failure
Addison's disease
Administration site thrombosis
Administration site vasculitis
Adrenal thrombosis
Adverse event following immunisation
Ageusia
Agranulocytosis
Air embolism
Alanine aminotransferase abnormal
Alanine aminotransferase increased
Alcoholic seizure
Allergic bronchopulmonary mycosis
Allergic oedema
Alloimmune hepatitis
Alopecia areata
Alpers disease
Alveolar proteinosis
Ammonia abnormal
Ammonia increased
Amniotic cavity infection
Amygdalohippocampectomy
Amyloid arthropathy
Amyloidosis
Amyloidosis senile
Anaphylactic reaction
Anaphylactic shock
Anaphylactic transfusion reaction
Anaphylactoid reaction
Anaphylactoid shock
Anaphylactoid syndrome of pregnancy
Angioedema
Angiopathic neuropathy
Ankylosing spondylitis
Anosmia
Antiacetylcholine receptor antibody positive
Anti-actin antibody positive
Anti-aquaporin-4 antibody positive
Anti-basal ganglia antibody positive
Anti-cyclic citrullinated peptide antibody positive
Anti-epithelial antibody positive
Anti-erythrocyte antibody positive
Anti-exosome complex antibody positive
Anti-GAD antibody negative
Anti-GAD antibody positive
Anti-ganglioside antibody positive
Antigliadin antibody positive
Anti-glomerular basement membrane antibody positive
Anti-glomerular basement membrane disease
Anti-glycyl-tRNA synthetase antibody positive
Anti-HLA antibody test positive
Anti-IA2 antibody positive
Anti-insulin antibody increased
Anti-insulin antibody positive
Anti-insulin receptor antibody increased
Anti-insulin receptor antibody positive
Anti-interferon antibody negative
Anti-interferon antibody positive
Anti-islet cell antibody positive
Antimitochondrial antibody positive
Anti-muscle specific kinase antibody positive
Anti-myelin-associated glycoprotein antibodies positive
Anti-myelin-associated glycoprotein associated polyneuropathy
Antimyocardial antibody positive
Anti-neuronal antibody positive
Antineutrophil cytoplasmic antibody increased
Antineutrophil cytoplasmic antibody positive
Anti-neutrophil cytoplasmic antibody positive vasculitis
Anti-NMDA antibody positive
Antinuclear antibody increased
Antinuclear antibody positive
Antiphospholipid antibodies positive
Antiphospholipid syndrome
Anti-platelet antibody positive
Anti-prothrombin antibody positive
Antiribosomal P antibody positive
Anti-RNA polymerase III antibody positive
Anti-saccharomyces cerevisiae antibody test positive
Anti-sperm antibody positive
Anti-SRP antibody positive
Antisynthetase syndrome
Anti-thyroid antibody positive
Anti-transglutaminase antibody increased
Anti-VGCC antibody positive
Anti-VGKC antibody positive
Anti-vimentin antibody positive
Antiviral prophylaxis
Antiviral treatment
Anti-zinc transporter 8 antibody positive
Aortic embolus
Aortic thrombosis
Aortitis
Aplasia pure red cell
Aplastic anaemia
Application site thrombosis
Application site vasculitis
Arrhythmia
Arterial bypass occlusion
Arterial bypass thrombosis
Arterial thrombosis
Arteriovenous fistula thrombosis
Arteriovenous graft site stenosis
Arteriovenous graft thrombosis
Arteritis
Arteritis coronary
Arthralgia
Arthritis
Arthritis enteropathic
Ascites
Aseptic cavernous sinus thrombosis
Aspartate aminotransferase abnormal
Aspartate aminotransferase increased
Aspartate-glutamate-transporter deficiency
AST to platelet ratio index increased
AST/ALT ratio abnormal
Asthma
Asymptomatic COVID-19
Ataxia
Atheroembolism
Atonic seizures
Atrial thrombosis
Atrophic thyroiditis
Atypical benign partial epilepsy
Atypical pneumonia
Aura
Autoantibody positive
Autoimmune anaemia
Autoimmune aplastic anaemia
Autoimmune arthritis
Autoimmune blistering disease
Autoimmune cholangitis
Autoimmune colitis
Autoimmune demyelinating disease
Autoimmune dermatitis
Autoimmune disorder
Autoimmune encephalopathy
Autoimmune endocrine disorder
Autoimmune enteropathy
Autoimmune eye disorder
Autoimmune haemolytic anaemia
Autoimmune heparin-induced thrombocytopenia
Autoimmune hepatitis
Autoimmune hyperlipidaemia
Autoimmune hypothyroidism
Autoimmune inner ear disease
Autoimmune lung disease
Autoimmune lymphoproliferative syndrome
Autoimmune myocarditis
Autoimmune myositis
Autoimmune nephritis
Autoimmune neuropathy
Autoimmune neutropenia
Autoimmune pancreatitis
Autoimmune pancytopenia
Autoimmune pericarditis
Autoimmune retinopathy
Autoimmune thyroid disorder
Autoimmune thyroiditis
Autoimmune uveitis
Autoinflammation with infantile enterocolitis
Autoinflammatory disease
Automatism epileptic
Autonomic nervous system imbalance
Autonomic seizure
Axial spondyloarthritis
Axillary vein thrombosis
Axonal and demyelinating polyneuropathy
Axonal neuropathy
Bacterascites
Baltic myoclonic epilepsy
Band sensation
Basedow's disease
Basilar artery thrombosis
Basophilopenia
B-cell aplasia
Behcet's syndrome
Benign ethnic neutropenia
Benign familial neonatal convulsions
Benign familial pemphigus
Benign rolandic epilepsy
Beta-2 glycoprotein antibody positive
Bickerstaff's encephalitis
Bile output abnormal
Bile output decreased
Biliary ascites
Bilirubin conjugated abnormal
Bilirubin conjugated increased
Bilirubin urine present
Biopsy liver abnormal
Biotinidase deficiency
Birdshot chorioretinopathy
Blood alkaline phosphatase abnormal
Blood alkaline phosphatase increased
Blood bilirubin abnormal
Blood bilirubin increased
Blood bilirubin unconjugated increased
Blood cholinesterase abnormal
Blood cholinesterase decreased
Blood pressure decreased
Blood pressure diastolic decreased
Blood pressure systolic decreased
Blue toe syndrome
Brachiocephalic vein thrombosis
Brain stem embolism
Brain stem thrombosis
Bromosulphthalein test abnormal
Bronchial oedema
Bronchitis
Bronchitis mycoplasmal
Bronchitis viral
Bronchopulmonary aspergillosis allergic
Bronchospasm
Budd-Chiari syndrome
Bulbar palsy
Butterfly rash
C1q nephropathy
Caesarean section
Calcium embolism
Capillaritis
Caplan's syndrome
Cardiac amyloidosis
Cardiac arrest
Cardiac failure
Cardiac failure acute
Cardiac sarcoidosis
Cardiac ventricular thrombosis
Cardiogenic shock
Cardiolipin antibody positive
Cardiopulmonary failure
Cardio-respiratory arrest
Cardio-respiratory distress
Cardiovascular insufficiency
Carotid arterial embolus
Carotid artery thrombosis
Cataplexy
Catheter site thrombosis
Catheter site vasculitis
Cavernous sinus thrombosis
CDKL5 deficiency disorder
CEC syndrome
Cement embolism
Central nervous system lupus
Central nervous system vasculitis
Cerebellar artery thrombosis
Cerebellar embolism
Cerebral amyloid angiopathy
Cerebral arteritis
Cerebral artery embolism
Cerebral artery thrombosis
Cerebral gas embolism
Cerebral microembolism
Cerebral septic infarct
Cerebral thrombosis
Cerebral venous sinus thrombosis
Cerebral venous thrombosis
Cerebrospinal thrombotic tamponade
Cerebrovascular accident
Change in seizure presentation
Chest discomfort
Child-Pugh-Turcotte score abnormal
Child-Pugh-Turcotte score increased
Chillblains
Choking
Choking sensation
Cholangitis sclerosing
Chronic autoimmune glomerulonephritis
Chronic cutaneous lupus erythematosus
Chronic fatigue syndrome
Chronic gastritis
Chronic inflammatory demyelinating polyradiculoneuropathy
Chronic lymphocytic inflammation with pontine perivascular enhancement responsive to steroids
Chronic recurrent multifocal osteomyelitis
Chronic respiratory failure
Chronic spontaneous urticaria
Circulatory collapse
Circumoral oedema
Circumoral swelling
Clinically isolated syndrome
Clonic convulsion
Coeliac disease
Cogan's syndrome
Cold agglutinins positive
Cold type haemolytic anaemia
Colitis
Colitis erosive
Colitis herpes
Colitis microscopic
Colitis ulcerative
Collagen disorder
Collagen-vascular disease
Complement factor abnormal
Complement factor C1 decreased
Complement factor C2 decreased
Complement factor C3 decreased
Complement factor C4 decreased
Complement factor decreased
Computerised tomogram liver abnormal
Concentric sclerosis
Congenital anomaly
Congenital bilateral perisylvian syndrome
Congenital herpes simplex infection
Congenital myasthenic syndrome
Congenital varicella infection
Congestive hepatopathy
Convulsion in childhood
Convulsions local
Convulsive threshold lowered
Coombs positive haemolytic anaemia
Coronary artery disease
Coronary artery embolism
Coronary artery thrombosis
Coronary bypass thrombosis
Coronavirus infection
Coronavirus test
Coronavirus test negative
Coronavirus test positive
Corpus callosotomy
Cough
Cough variant asthma
COVID-19
COVID-19 immunisation
COVID-19 pneumonia
COVID-19 prophylaxis
COVID-19 treatment
Cranial nerve disorder
Cranial nerve palsies multiple
Cranial nerve paralysis
CREST syndrome
Crohn's disease
Cryofibrinogenaemia
Cryoglobulinaemia
CSF oligoclonal band present
CSWS syndrome
Cutaneous amyloidosis
Cutaneous lupus erythematosus
Cutaneous sarcoidosis
Cutaneous vasculitis
Cyanosis
Cyclic neutropenia
Cystitis interstitial
Cytokine release syndrome
Cytokine storm
De novo purine synthesis inhibitors associated acute inflammatory syndrome
Death neonatal
Deep vein thrombosis
Deep vein thrombosis postoperative
Deficiency of bile secretion
Deja vu
Demyelinating polyneuropathy
Demyelination
Dermatitis
Dermatitis bullous
Dermatitis herpetiformis
Dermatomyositis
Device embolisation
Device related thrombosis
Diabetes mellitus
Diabetic ketoacidosis
Diabetic mastopathy
Dialysis amyloidosis
Dialysis membrane reaction
Diastolic hypotension
Diffuse vasculitis
Digital pitting scar
Disseminated intravascular coagulation
Disseminated intravascular coagulation in newborn
Disseminated neonatal herpes simplex
Disseminated varicella
Disseminated varicella zoster vaccine virus infection
Disseminated varicella zoster virus infection
DNA antibody positive
Double cortex syndrome
Double stranded DNA antibody positive
Dreamy state
Dressler's syndrome
Drop attacks
Drug withdrawal convulsions
Dyspnoea
Early infantile epileptic encephalopathy with burst-suppression
Eclampsia
Eczema herpeticum
Embolia cutis medicamentosa
Embolic cerebellar infarction
Embolic cerebral infarction
Embolic pneumonia
Embolic stroke
Embolism
Embolism arterial
Embolism venous
Encephalitis
Encephalitis allergic
Encephalitis autoimmune
Encephalitis brain stem
Encephalitis haemorrhagic
Encephalitis periaxialis diffusa
Encephalitis postimmunisation
Encephalomyelitis
Encephalopathy
Endocrine disorder
Endocrine ophthalmopathy
Endotracheal intubation
Enteritis
Enteritis leukopenic
Enterobacter pneumonia
Enterocolitis
Enteropathic spondylitis
Eosinopenia
Eosinophilic fasciitis
Eosinophilic granulomatosis with polyangiitis
Eosinophilic oesophagitis
Epidermolysis
Epilepsy
Epilepsy surgery
Epilepsy with myoclonic-atonic seizures
Epileptic aura
Epileptic psychosis
Erythema
Erythema induratum
Erythema multiforme
Erythema nodosum
Evans syndrome
Exanthema subitum
Expanded disability status scale score decreased
Expanded disability status scale score increased
Exposure to communicable disease
Exposure to SARS-CoV-2
Eye oedema
Eye pruritus
Eye swelling
Eyelid oedema
Face oedema
Facial paralysis
Facial paresis
Faciobrachial dystonic seizure
Fat embolism
Febrile convulsion
Febrile infection-related epilepsy syndrome
Febrile neutropenia
Felty's syndrome
Femoral artery embolism
Fibrillaryglomerulonephritis
Fibromyalgia
Flushing
Foaming at mouth
Focal cortical resection
Focal dyscognitive seizures
Foetal distress syndrome
Foetal placental thrombosis
Foetor hepaticus
Foreign body embolism
Frontal lobe epilepsy
Fulminant type 1 diabetes mellitus
Galactose elimination capacity test abnormal
Galactose elimination capacity test decreased
Gamma-glutamyltransferase abnormal
Gamma-glutamyltransferase increased
Gastritis herpes
Gastrointestinal amyloidosis
Gelastic seizure
Generalised onset non-motor seizure
Generalised tonic-clonic seizure
Genital herpes
Genital herpes simplex
Genital herpes zoster
Giant cell arteritis
Glomerulonephritis
Glomerulonephritis membranoproliferative
Glomerulonephritis membranous
Glomerulonephritis rapidly progressive
Glossopharyngeal nerve paralysis
Glucose transporter type 1 deficiency syndrome
Glutamate dehydrogenase increased
Glycocholic acid increased
GM2 gangliosidosis
Goodpasture's syndrome
Graft thrombosis
Granulocytopenia
Granulocytopenia neonatal
Granulomatosis with polyangiitis
Granulomatous dermatitis
Grey matter heterotopia
Guanase increased
Guillain-Barre syndrome
Haemolytic anaemia
Haemophagocytic lymphohistiocytosis
Haemorrhage
Haemorrhagic ascites
Haemorrhagic disorder
Haemorrhagic pneumonia
Haemorrhagic varicella syndrome
Haemorrhagic vasculitis
Hantavirus pulmonary infection
Hashimoto's encephalopathy
Hashitoxicosis
Hemimegalencephaly
Henoch-Schonlein purpura
Henoch-Schonlein purpura nephritis
Hepaplastin abnormal
Hepaplastin decreased
Heparin-induced thrombocytopenia
Hepatic amyloidosis
Hepatic artery embolism
Hepatic artery flow decreased
Hepatic artery thrombosis
Hepatic enzyme abnormal
Hepatic enzyme decreased
Hepatic enzyme increased
Hepatic fibrosis marker abnormal
Hepatic fibrosis marker increased
Hepatic function abnormal
Hepatic hydrothorax
Hepatic hypertrophy
Hepatic hypoperfusion
Hepatic lymphocytic infiltration
Hepatic mass
Hepatic pain
Hepatic sequestration
Hepatic vascular resistance increased
Hepatic vascular thrombosis
Hepatic vein embolism
Hepatic vein thrombosis
Hepatic venous pressure gradient abnormal
Hepatic venous pressure gradient increased
Hepatitis
Hepatobiliary scan abnormal
Hepatomegaly
Hepatosplenomegaly
Hereditary angioedema with C1 esterase inhibitor deficiency
Herpes dermatitis
Herpes gestationis
Herpes oesophagitis
Herpes ophthalmic
Herpes pharyngitis
Herpes sepsis
Herpes simplex
Herpes simplex cervicitis
Herpes simplex colitis
Herpes simplex encephalitis
Herpes simplex gastritis
Herpes simplex hepatitis
Herpes simplex meningitis
Herpes simplex meningoencephalitis
Herpes simplex meningomyelitis
Herpes simplex necrotising retinopathy
Herpes simplex oesophagitis
Herpes simplex otitis externa
Herpes simplex pharyngitis
Herpes simplex pneumonia
Herpes simplex reactivation
Herpes simplex sepsis
Herpes simplex viraemia
Herpes simplex virus conjunctivitis neonatal
Herpes simplex visceral
Herpes virus infection
Herpes zoster
Herpes zoster cutaneous disseminated
Herpes zoster infection neurological
Herpes zoster meningitis
Herpes zoster meningoencephalitis
Herpes zoster meningomyelitis
Herpes zoster meningoradiculitis
Herpes zoster necrotising retinopathy
Herpes zoster oticus
Herpes zoster pharyngitis
Herpes zoster reactivation
Herpetic radiculopathy
Histone antibody positive
Hoigne's syndrome
Human herpesvirus 6 encephalitis
Human herpesvirus 6 infection
Human herpesvirus 6 infection reactivation
Human herpesvirus 7 infection
Human herpesvirus 8 infection
Hyperammonaemia
Hyperbilirubinaemia
Hypercholia
Hypergammaglobulinaemia benign monoclonal
Hyperglycaemic seizure
Hypersensitivity
Hypersensitivity vasculitis
Hyperthyroidism
Hypertransaminasaemia
Hyperventilation
Hypoalbuminaemia
Hypocalcaemic seizure
Hypogammaglobulinaemia
Hypoglossal nerve paralysis
Hypoglossal nerve paresis
Hypoglycaemic seizure
Hyponatraemic seizure
Hypotension
Hypotensive crisis
Hypothenar hammer syndrome
Hypothyroidism
Hypoxia
Idiopathic CD4 lymphocytopenia
Idiopathic generalised epilepsy
Idiopathic interstitial pneumonia
Idiopathic neutropenia
Idiopathic pulmonary fibrosis
IgA nephropathy
IgM nephropathy
IIIrd nerve paralysis
IIIrd nerve paresis
Iliac artery embolism
Immune thrombocytopenia
Immune-mediated adverse reaction
Immune-mediated cholangitis
Immune-mediated cholestasis
Immune-mediated cytopenia
Immune-mediated encephalitis
Immune-mediated encephalopathy
Immune-mediated endocrinopathy
Immune-mediated enterocolitis
Immune-mediated gastritis
Immune-mediated hepatic disorder
Immune-mediated hepatitis
Immune-mediated hyperthyroidism
Immune-mediated hypothyroidism
Immune-mediated myocarditis
Immune-mediated myositis
Immune-mediated nephritis
Immune-mediated neuropathy
Immune-mediated pancreatitis
Immune-mediated pneumonitis
Immune-mediated renal disorder
Immune-mediated thyroiditis
Immune-mediated uveitis
Immunoglobulin G4 related disease
Immunoglobulins abnormal
Implant site thrombosis
Inclusion body myositis
Infantile genetic agranulocytosis
Infantile spasms
Infected vasculitis
Infective thrombosis
Inflammation
Inflammatory bowel disease
Infusion site thrombosis
Infusion site vasculitis
Injection site thrombosis
Injection site urticaria
Injection site vasculitis
Instillation site thrombosis
Insulin autoimmune syndrome
Interstitial granulomatous dermatitis
Interstitial lung disease
Intracardiac mass
Intracardiac thrombus
Intracranial pressure increased
Intrapericardial thrombosis
Intrinsic factor antibody abnormal
Intrinsic factor antibody positive
IPEX syndrome
Irregular breathing
IRVAN syndrome
IVth nerve paralysis
IVth nerve paresis
JC polyomavirus test positive
JC virus CSF test positive
Jeavons syndrome
Jugular vein embolism
Jugular vein thrombosis
Juvenile idiopathic arthritis
Juvenile myoclonic epilepsy
Juvenile polymyositis
Juvenile psoriatic arthritis
Juvenile spondyloarthritis
Kaposi sarcoma inflammatory cytokine syndrome
Kawasaki's disease
Kayser-Fleischer ring
Keratoderma blenorrhagica
Ketosis-prone diabetes mellitus
Kounis syndrome
Lafora's myoclonic epilepsy
Lambl's excrescences
Laryngeal dyspnoea
Laryngeal oedema
Laryngeal rheumatoid arthritis
Laryngospasm
Laryngotracheal oedema
Latent autoimmune diabetes in adults
LE cells present
Lemierre syndrome
Lennox-Gastaut syndrome
Leucine aminopeptidase increased
Leukoencephalomyelitis
Leukoencephalopathy
Leukopenia
Leukopenia neonatal
Lewis-Sumner syndrome
Lhermitte's sign
Lichen planopilaris
Lichen planus
Lichen sclerosus
Limbic encephalitis
Linear IgA disease
Lip oedema
Lip swelling
Liver function test abnormal
Liver function test decreased
Liver function test increased
Liver induration
Liver injury
Liver iron concentration abnormal
Liver iron concentration increased
Liver opacity
Liver palpable
Liver sarcoidosis
Liver scan abnormal
Livertenderness
Low birth weight baby
Lower respiratory tract herpes infection
Lower respiratory tract infection
Lower respiratory tract infection viral
Lung abscess
Lupoid hepatic cirrhosis
Lupus cystitis
Lupus encephalitis
Lupus endocarditis
Lupus enteritis
Lupus hepatitis
Lupus myocarditis
Lupus myositis
Lupus nephritis
Lupus pancreatitis
Lupus pleurisy
Lupus pneumonitis
Lupus vasculitis
Lupus-like syndrome
Lymphocytic hypophysitis
Lymphocytopenia neonatal
Lymphopenia
MAGIC syndrome
Magnetic resonance imaging liver abnormal
Magnetic resonance proton density fat fraction measurement
Mahler sign
Manufacturing laboratory analytical testing issue
Manufacturing materials issue
Manufacturing production issue
Marburg's variant multiple sclerosis
Marchiafava-Bignami disease
Marine Lenhart syndrome
Mastocytic enterocolitis
Maternal exposure during pregnancy
Medical device site thrombosis
Medical device site vasculitis
MELAS syndrome
Meningitis
Meningitis aseptic
Meningitis herpes
Meningoencephalitis herpes simplex neonatal
Meningoencephalitis herpetic
Meningomyelitis herpes
MERS-CoV test
MERS-CoV test negative
MERS-CoV test positive
Mesangioproliferative glomerulonephritis
Mesenteric artery embolism
Mesenteric artery thrombosis
Mesenteric vein thrombosis
Metapneumovirus infection
Metastatic cutaneous Crohn's disease
Metastatic pulmonary embolism
Microangiopathy
Microembolism
Microscopic polyangiitis
Middle East respiratory syndrome
Migraine-triggered seizure
Miliary pneumonia
Miller Fisher syndrome
Mitochondrial aspartate aminotransferase increased
Mixed connective tissue disease
Model for end stage liver disease score abnormal
Model for end stage liver disease score increased
Molar ratio of total branched-chain amino acid to tyrosine
Molybdenum cofactor deficiency
Monocytopenia
Mononeuritis
Mononeuropathy multiplex
Morphoea
Morvan syndrome
Mouth swelling
Moyamoya disease
Multifocal motor neuropathy
Multiple organ dysfunction syndrome
Multiple sclerosis
Multiple sclerosis relapse
Multiple sclerosis relapse prophylaxis
Multiple subpial transection
Multisystem inflammatory syndrome in children
Muscular sarcoidosis
Myasthenia gravis
Myasthenia gravis crisis
Myasthenia gravis neonatal
Myasthenic syndrome
Myelitis
Myelitis transverse
Myocardial infarction
Myocarditis
Myocarditis post infection
Myoclonic epilepsy
Myoclonic epilepsy and ragged-red fibres
Myokymia
Myositis
Narcolepsy
Nasal herpes
Nasal obstruction
Necrotising herpetic retinopathy
Neonatal Crohn's disease
Neonatal epileptic seizure
Neonatal lupus erythematosus
Neonatal mucocutaneous herpes simplex
Neonatal pneumonia
Neonatal seizure
Nephritis
Nephrogenic systemic fibrosis
Neuralgic amyotrophy
Neuritis
Neuritis cranial
Neuromyelitis optica pseudo relapse
Neuromyelitis optica spectrum disorder
Neuromyotonia
Neuronal neuropathy
Neuropathy peripheral
Neuropathy, ataxia, retinitis pigmentosa syndrome
Neuropsychiatric lupus
Neurosarcoidosis
Neutropenia
Neutropenia neonatal
Neutropenic colitis
Neutropenic infection
Neutropenic sepsis
Nodular rash
Nodular vasculitis
Noninfectious myelitis
Noninfective encephalitis
Noninfective encephalomyelitis
Noninfective oophoritis
Obstetrical pulmonary embolism
Occupational exposure to communicable disease
Occupational exposure to SARS-CoV-2
Ocular hyperaemia
Ocular myasthenia
Ocular pemphigoid
Ocular sarcoidosis
Ocular vasculitis
Oculofacial paralysis
Oedema
Oedema blister
Oedema due to hepatic disease
Oedema mouth
Oesophageal achalasia
Ophthalmic artery thrombosis
Ophthalmic herpes simplex
Ophthalmic herpes zoster
Ophthalmic vein thrombosis
Optic neuritis
Optic neuropathy
Optic perineuritis
Oral herpes
Oral lichen planus
Oropharyngeal oedema
Oropharyngeal spasm
Oropharyngeal swelling
Osmotic demyelination syndrome
Ovarian vein thrombosis
Overlap syndrome
Paediatric autoimmune neuropsychiatric disorders associated with streptococcal infection
Paget-Schroetter syndrome
Palindromic rheumatism
Palisaded neutrophilic granulomatous dermatitis
Palmoplantar keratoderma
Palpable purpura
Pancreatitis
Panencephalitis
Papillophlebitis
Paracancerous pneumonia
Paradoxical embolism
Parainfluenzae viral laryngotracheobronchitis
Paraneoplastic dermatomyositis
Paraneoplastic pemphigus
Paraneoplastic thrombosis
Paresis cranial nerve
Parietal cell antibody positive
Paroxysmal nocturnal haemoglobinuria
Partial seizures
Partial seizures with secondary generalisation
Patient isolation
Pelvic venous thrombosis
Pemphigoid
Pemphigus
Penile vein thrombosis
Pericarditis
Pericarditis lupus
Perihepatic discomfort
Periorbital oedema
Periorbital swelling
Peripheral artery thrombosis
Peripheral embolism
Peripheral ischaemia
Peripheral vein thrombus extension
Periportal oedema
Peritoneal fluid protein abnormal
Peritoneal fluid protein decreased
Peritoneal fluid protein increased
Peritonitis lupus
Pernicious anaemia
Petit mal epilepsy
Pharyngeal oedema
Pharyngeal swelling
Pityriasis lichenoides et varioliformis acuta
Placenta praevia
Pleuroparenchymal fibroelastosis
Pneumobilia
Pneumonia
Pneumonia adenoviral
Pneumonia cytomegaloviral
Pneumonia herpes viral
Pneumonia influenzal
Pneumonia measles
Pneumonia mycoplasmal
Pneumonia necrotising
Pneumonia parainfluenzae viral
Pneumonia respiratory syncytial viral
Pneumonia viral
POEMS syndrome
Polyarteritis nodosa
Polyarthritis
Polychondritis
Polyglandular autoimmune syndrome type I
Polyglandular autoimmune syndrome type II
Polyglandular autoimmune syndrome type III
Polyglandular disorder
Polymicrogyria
Polymyalgia rheumatica
Polymyositis
Polyneuropathy
Polyneuropathy idiopathic progressive
Portal pyaemia
Portal vein embolism
Portal vein flow decreased
Portal vein pressure increased
Portal vein thrombosis
Portosplenomesenteric venous thrombosis
Post procedural hypotension
Post procedural pneumonia
Post procedural pulmonary embolism
Post stroke epilepsy
Post stroke seizure
Post thrombotic retinopathy
Post thrombotic syndrome
Post viral fatigue syndrome
Postictal headache
Postictal paralysis
Postictal psychosis
Postictal state
Postoperative respiratory distress
Postoperative respiratory failure
Postoperative thrombosis
Postpartum thrombosis
Postpartum venous thrombosis
Postpericardiotomy syndrome
Post-traumatic epilepsy
Postural orthostatic tachycardia syndrome
Precerebral artery thrombosis
Pre-eclampsia
Preictal state
Premature labour
Premature menopause
Primary amyloidosis
Primary biliary cholangitis
Primary progressive multiple sclerosis
Procedural shock
Proctitis herpes
Proctitis ulcerative
Product availability issue
Product distribution issue
Product supply issue
Progressive facial hemiatrophy
Progressive multifocal leukoencephalopathy
Progressive multiple sclerosis
Progressive relapsing multiple sclerosis
Prosthetic cardiac valve thrombosis
Pruritus
Pruritus allergic
Pseudovasculitis
Psoriasis
Psoriatic arthropathy
Pulmonary amyloidosis
Pulmonary artery thrombosis
Pulmonary embolism
Pulmonary fibrosis
Pulmonary haemorrhage
Pulmonary microemboli
Pulmonary oil microembolism
Pulmonary renal syndrome
Pulmonary sarcoidosis
Pulmonary sepsis
Pulmonary thrombosis
Pulmonary tumour thrombotic microangiopathy
Pulmonary vasculitis
Pulmonary veno-occlusive disease
Pulmonary venous thrombosis
Pyoderma gangrenosum
Pyostomatitis vegetans
Pyrexia
Quarantine
Radiation leukopenia
Radiculitis brachial
Radiologically isolated syndrome
Rash
Rash erythematous
Rash pruritic
Rasmussen encephalitis
Raynaud's phenomenon
Reactive capillary endothelial proliferation
Relapsing multiple sclerosis
Relapsing-remitting multiple sclerosis
Renal amyloidosis
Renal arteritis
Renal artery thrombosis
Renal embolism
Renal failure
Renal vascular thrombosis
Renal vasculitis
Renal vein embolism
Renal vein thrombosis
Respiratory arrest
Respiratory disorder
Respiratory distress
Respiratory failure
Respiratory paralysis
Respiratory syncytial virus bronchiolitis
Respiratory syncytial virus bronchitis
Retinal artery embolism
Retinal artery occlusion
Retinal artery thrombosis
Retinal vascular thrombosis
Retinal vasculitis
Retinal vein occlusion
Retinal vein thrombosis
Retinol binding protein decreased
Retinopathy
Retrograde portal vein flow
Retroperitoneal fibrosis
Reversible airways obstruction
Reynold's syndrome
Rheumatic brain disease
Rheumatic disorder
Rheumatoid arthritis
Rheumatoid factor increased
Rheumatoid factor positive
Rheumatoid factor quantitative increased
Rheumatoid lung
Rheumatoid neutrophilic dermatosis
Rheumatoid nodule
Rheumatoid nodule removal
Rheumatoid scleritis
Rheumatoid vasculitis
Saccadic eye movement
SAPHO syndrome
Sarcoidosis
SARS-CoV-1 test
SARS-CoV-1 test negative
SARS-CoV-1 test positive
SARS-CoV-2 antibody test
SARS-CoV-2 antibody test negative
SARS-CoV-2 antibody test positive
SARS-CoV-2 carrier
SARS-CoV-2 sepsis
SARS-CoV-2 test
SARS-CoV-2 test false negative
SARS-CoV-2 test false positive
SARS-CoV-2 test negative
SARS-CoV-2 test positive
SARS-CoV-2 viraemia
Satoyoshi syndrome
Schizencephaly
Scleritis
Sclerodactylia
Scleroderma
Scleroderma associated digital ulcer
Scleroderma renal crisis
Scleroderma-like reaction
Secondary amyloidosis
Secondary cerebellar degeneration
Secondary progressive multiple sclerosis
Segmented hyalinising vasculitis
Seizure
Seizure anoxic
Seizure cluster
Seizure like phenomena
Seizure prophylaxis
Sensation of foreign body
Septic embolus
Septic pulmonary embolism
Severe acute respiratory syndrome
Severe myoclonic epilepsy of infancy
Shock
Shock symptom
Shrinking lung syndrome
Shunt thrombosis
Silent thyroiditis
Simple partial seizures
Sjogren's syndrome
Skin swelling
SLE arthritis
Smooth muscle antibody positive
Sneezing
Spinal artery embolism
Spinal artery thrombosis
Splenic artery thrombosis
Splenic embolism
Splenic thrombosis
Splenic vein thrombosis
Spondylitis
Spondyloarthropathy
Spontaneous heparin-induced thrombocytopenia syndrome
Status epilepticus
Stevens-Johnson syndrome
Stiff leg syndrome
Stiff person syndrome
Stillbirth
Still's disease
Stoma site thrombosis
Stoma site vasculitis
Stress cardiomyopathy
Stridor
Subacute cutaneous lupus erythematosus
Subacute endocarditis
Subacute inflammatory demyelinating polyneuropathy
Subclavian artery embolism
Subclavian artery thrombosis
Subclavian vein thrombosis
Sudden unexplained death in epilepsy
Superior sagittal sinus thrombosis
Susac's syndrome
Suspected COVID-19
Swelling
Swelling face
Swelling of eyelid
Swollen tongue
Sympathetic ophthalmia
Systemic lupus erythematosus
Systemic lupus erythematosus disease activity index abnormal
Systemic lupus erythematosus disease activity index decreased
Systemic lupus erythematosus disease activity index increased
Systemic lupus erythematosus rash
Systemic scleroderma
Systemic sclerosis pulmonary
Tachycardia
Tachypnoea
Takayasu's arteritis
Temporal lobe epilepsy
Terminal ileitis
Testicular autoimmunity
Throat tightness
Thromboangiitis obliterans
Thrombocytopenia
Thrombocytopenic purpura
Thrombophlebitis
Thrombophlebitis migrans
Thrombophlebitis neonatal
Thrombophlebitis septic
Thrombophlebitis superficial
Thromboplastin antibody positive
Thrombosis
Thrombosis corpora cavernosa
Thrombosis in device
Thrombosis mesenteric vessel
Thrombotic cerebral infarction
Thrombotic microangiopathy
Thrombotic stroke
Thrombotic thrombocytopenic purpura
Thyroid disorder
Thyroid stimulating immunoglobulin increased
Thyroiditis
Tongue amyloidosis
Tongue biting
Tongue oedema
Tonic clonic movements
Tonic convulsion
Tonic posturing
Topectomy
Total bile acids increased
Toxic epidermal necrolysis
Toxic leukoencephalopathy
Toxic oil syndrome
Tracheal obstruction
Tracheal oedema
Tracheobronchitis
Tracheobronchitis mycoplasmal
Tracheobronchitis viral
Transaminases abnormal
Transaminases increased
Transfusion-related alloimmune neutropenia
Transient epileptic amnesia
Transverse sinus thrombosis
Trigeminal nerve paresis
Trigeminal neuralgia
Trigeminal palsy
Truncus coeliacus thrombosis
Tuberous sclerosis complex
Tubulointerstitial nephritis and uveitis syndrome
Tumefactive multiple sclerosis
Tumour embolism
Tumour thrombosis
Type 1 diabetes mellitus
Type I hypersensitivity
Type III immune complex mediated reaction
Uhthoff's phenomenon
Ulcerative keratitis
Ultrasound liver abnormal
Umbilical cord thrombosis
Uncinate fits
Undifferentiated connective tissue disease
Upper airway obstruction
Urine bilirubin increased
Urobilinogen urine decreased
Urobilinogen urine increased
Urticaria
Urticaria papular
Urticarial vasculitis
Uterine rupture
Uveitis
Vaccination site thrombosis
Vaccination site vasculitis
Vagus nerve paralysis
Varicella
Varicella keratitis
Varicella post vaccine
Varicella zoster gastritis
Varicella zoster oesophagitis
Varicella zoster pneumonia
Varicella zoster sepsis
Varicella zoster virus infection
Vasa praevia
Vascular graft thrombosis
Vascular pseudoaneurysm thrombosis
Vascular purpura
Vascular stent thrombosis
Vasculitic rash
Vasculitic ulcer
Vasculitis
Vasculitis gastrointestinal
Vasculitis necrotising
Vena cava embolism
Vena cava thrombosis
Venous intravasation
Venous recanalisation
Venous thrombosis
Venous thrombosis in pregnancy
Venous thrombosis limb
Venous thrombosis neonatal
Vertebral artery thrombosis
Vessel puncture site thrombosis
Visceral venous thrombosis
VIth nerve paralysis
VIth nerve paresis
Vitiligo
Vocal cord paralysis
Vocal cord paresis
Vogt-Koyanagi-Harada disease
Warm type haemolytic anaemia
Wheezing
White nipple sign
XIth nerve paralysis
X-ray hepatobiliary abnormal
Young's syndrome
Zika virus associated Guillain Barre syndrome
A Brief History of man made pathogens designed by Ralph Baric, Peter Daszak, Shi Zhengli and Moderna and funded by Fauci, the NIH, the NIAID and the US Government to carry out the research necessary for the creation of SARS, MERS and Covid-19
1984: Dr Anthony Fauci appointed director of the NIAID (National institute of Allergies and Infectious diseases) - There is an Orwellian Appointment for you.
1986 July1: https://grantome.com/grant/NIH/R01-AI023946-01
1986 - 1999 funding amounts not specified and then funded by $1,987,840 over 7 years from 2000 to 2007 excluding 2002.
NIAID (National Institute of Allergies and Infectious Diseases) funding Ralph Baric at University of North Carolina, Chapel Hill.
Subject: Mechanism of MHV Replication (Mouse Hepatitis Virus). This was the start of the partnership between Fauci and Baric.
1999: U.S. Dept. of Health & Human Services (HHS) funds research amplifying the infectious character of Coronaviruses.
1999: The Bill and Mellisa Gates Foundation set up GAVI (Global Alliance for Vaccines and Immunization) with a promise of $750 million in funding. So it was never going to be a bit part actor in the vaccine movie. - https://www.gavi.org/operating-model/gavis-partnership-model/bill-melinda-gates-foundation
2000: In May Ralph Baric successfully constructs a 28k base pair Coronavirus from smaller fragments by reverse transcription (making DNA from RNA) He makes an infectious TGE (Transmissable Gastroenteritis Virus - which is a type of Coronavirus) clone from isolated components of the genome. He files for US Patent 6,593,111 B2:
The invention is exemplified by, although not limited to, the assembly of full-length, functional coronavirus genomes. The present inventors have successfully assembled a full length infectious clone of transmissible gastroenteritis virus (TGE). Using a novel approach, six adjoining cDNA subclones that span the entire TGE genome were isolated. Each clone was engineered with unique flanking interconnecting junctions which dictate a precise, systematic assembly with only the correct adjacent cDNA subclones,
resulting in an intact TGE cDNA construct of about approximately 28.5 Kb in length - https://patents.justia.com/patent/6593111
.
Among other advantages, full-length infectious clones of TGE permit the precise genetic modification of the coronavirus genome - https://patents.justia.com/patent/6593111
2001: April 20: NIH Grant GM63228 funds Ralph Baric et al at the University of North Carolina at Chapel Hill to do Chimera research to transform the original SARS Coronavirus which was pathogenic only to animals, existing in nature as a pathogen for dogs and rabbits, to make it pathogenic to mankind targeting lung epithelial cells. The justification for this research was that it was supposedly designed as a vector virus to distribute HIV vaccines. This resulted in US patent application US28531801P
2001 May21: Ralph Baric and Boyd Yount (Assigned to University of North Carolina at Chapel Hill) file US Patent 6,593,111 B2 Directional Assembly of Large Viral Genomes and Chromosomes The Patent Office search report found: Lai, Michael M.C "The making of infectious vial RNA: No size limit in sight" PNAS vol 97 No 10, May 9, 2000 pp 5025-5027 And it found: Thiel et al "Infectious RNA transcribed in vitro from a cDNA copy of human coronavirus genome cloud in vaccinia virus 92: 1273-1261 (2001)
2002: April 19: The University of North Carolina files US patent 7279327 for an infectious replication defective coronavirus (to be used as a virus vector for an HIV vaccine), claiming priority from US28531801P. Inventors were: Kristopher M. Curtis, Boyd Yount, Ralph S. Baric
https://www.webmd.com/lung/news/20030411/sars-timeline-of-outbreak
2002 November 16: The first case of an atypical pneumonia is reported in the Guangdong province in southern China.
2003 February 25: First cases of unusual pneumonia reported in Hanoi, Vietnam.
2003 February 28: WHO officer Carlo Urbani, MD, examines an American businessman with an unknown form of pneumonia in a French hospital in Hanoi, Vietnam.
2003 March10: Urbani reports an unusual outbreak of the illness, which he calls sudden acute respiratory syndrome or SARS, to the main office of the WHO. He notes that the disease has infected an usually high number of healthcare workers (22) at the hospital (in Hanoi, Vietnam).
2003 March11: A similar outbreak of a mysterious respiratory disease is reported among healthcare workers in Hong Kong.
2003 March15: WHO issues a heightened global health alert about the mysterious pneumonia with a case definition of SARS as after cases in Singapore and Canada are also identified. The alert includes a rare emergency travel advisory to international travellers, healthcare professionals and health authorities.
2003 March17: An international network of 11 leading laboratories is established to determine the cause of SARS and develop potential treatments.
2003 March24: CDC officials present the first evidence that a new strain of a virus most frequently associated with upper respiratory infections and the common cold in humans called the coronavirus might be likely cause of SARS.
2003 March29: Carlo Urbani, who identified the first cases of SARS, dies as a result of the disease. Researchers later suggest naming the agent that causes the disease after the infectious disease expert.
2003 April4: President George W. Bush adds SARS to the list of quarantinable diseases, which gives the CDC the authority to isolate persons who might have been exposed to the disease.
2003 April12: Canadian researchers announce they have completed the first successful sequencing of the genome of the coronavirus believed to cause SARS.
2003 April14: CDC officials announce their laboratories have sequenced a nearly identical strain of the SARS-related coronavirus. The CDC version includes an additional 15 nucleotides, which provides the important beginning of the sequence.
2003 April16: A new form of a coronavirus never before seen in humans is confirmed as the cause of SARS according to Koch's postulates, which are four specific conditions that must be met for a pathogen to be confirmed as a causal agent of disease.
2003 April 25: CDC Patent filed and ultimately becomes US 7,220,852 (the patent on the RNA sequence) and 7,776,521 (the patent on the testing methodology). These patents give the U.S. Department of Health and Human Services the ability to control the commercial exploitation of SARS coronavirus.
2003 July2: WHO removes Toronto, Canada from its list of areas with recent local SARS transmission after 20 days passed since the last SARS case was reported and isolated.
2003 January26: Dr. Anthony Fauci appointed to the Bill and Melinda Gates Foundation’s Global Grand Challenges Scientific Advisory Board (served through 2010 - when he joined their Global Vaccine Action Plan).
2006 Chinese researchers combine HCV, HIV-1, SARS-CoV-1 & SARS-CoV-2: Huang Q, Cheng Y, Guo Q, Li Q. Preparation of a Chimeric Armored RNA as a Versatile Calibrator for Multiple Virus Assays. Clinchem 2006; 52(7):1446-1448 and Supplement A.Inform1999200020022003.
2007: NSF Grant IIS-0513650 (Italy, France and Indiana University) study addresses FIRST CRITICAL STEP to control a pandemic - shutdown International Travel. Given this knowledge why did Fauci tell Trump a Travel Ban was unnecessary?
2009 April15: ModernaTX INC is incorporated in Delaware USA
2010 August 6: Moderna (prior to its establishment) files U.S. Patent 9,447,164 which attracted the investment of (and “inventorship” for) venture capitalists at Flagship Ventures. This patent grew out of the work of Dr. Jason P. Schrum of Harvard Medical School supported by National Science Foundation Grant #0434507. While the application claims priority to August 2010, the application didn’t get finalized until October, 2015.
2010 September21: Wildlife Trust is rebranded to become ECO Health Alliance under the directorship of Peter Daszak.
2010: The World Health Organization (WHO), UNICEF, the National Institute of Allergy and Infectious Diseases (NIAID) and the Bill & Melinda Gates Foundation have announced a collaboration to increase coordination across the international vaccine community and create a Global Vaccine Action Plan.
https://www.gatesfoundation.org/ideas/media-center/press-releases/2010/12/global-health-leaders-launch-decade-of-vaccines-collaboration.
The Leadership Council is comprised of:
Dr. Margaret Chan, Director General of WHO;
Dr. Anthony S. Fauci, Director of NIAID, part of the National Institutes of Health;
Mr. Anthony Lake, Executive Director for UNICEF;
Ms. Joy Phumaphi, Chair of the International Advisory Committee and Executive Secretary, African Leaders Malaria Alliance
Dr. Tachi Yamada, President of Global Health at the Bill & Melinda Gates Foundation
2011 March9: ModernaTX (MODEfied RNA) was registered in Massachussetts
2012 September22: UK Identifies first case of MERS
2012-April2: Moderna claims priority to US201261618957P in its 5 patents cited below all of which refer to a double CGG codon Furin Cleavage site.
2013 December 16: Moderna files 4 patents referring to a double CGG codon Furin Cleavage site.
US9149506B2: Modified polynucleotides encoding septin-4 - https://patents.google.com/patent/US9149506B2/en
US9216205B2: Modified polynucleotides encoding granulysin - https://patents.google.com/patent/US9216205B2/en
US9255129B2: Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 - https://patents.google.com/patent/US9255129B2/en
US9301993B2: Modified polynucleotides encoding apoptosis inducing factor 1 - https://patents.google.com/patent/US9301993B2/en
2013: Baric and Chinese scientists isolate 3 coronaviruses from bats with HKU4 spike protein - unable to infect human cells. Yang Y...Baric RS, et al. Receptor usage and cell entry of bat coronavirus HKU4 provide insight into bat-to-human transmission of MERS coronavirus. PNAS 2014;111(34):12516-12521. Funded with NIH grants RO1AI089728 & R21AI109094.
2014 October 17: Obama Administration halts Gain-of-Function Research
2015 Dr. Zhengli et al “reengineered HKU4 spike aiming to build its capacity to infect human cells.” “To this end, we introduced two single mutations...mutations in these motifs in coronavirus spikes have demonstrated dramatic effects on viral entry into human cells.”
2015: Baric and Zhengli announce they can make a more dangerous, virulent and infectious virus. Two Mutations Were Critical for Bat-to-Human Transmission of Middle East Respiratory Syndrome Coronavirus (MERS). J Virol.2015;89(17):9199-9123. Funded by NIH grants RO1AI089728, RO1AI110700.
2015 July: South Korea had its last case of MERS. There were 2,494 confirmed laboratory cases and a total of 858 deaths in 27 countries; 80% of these cases came from Saudi Arabia. So the mortality rate for MERS was 34.4%. But it was not very transmissible. Infections were limited to family members, other hospital patients and health care workers who encountered MERS patients.
2016 June2: Moderna files US9587003B2 referring to a double CGG codon Furin Cleavage site: Modified polynucleotides for the production of oncology-related proteins and peptides - https://patents.google.com/patent/US9587003B2/en
2017: Gain-of-Function Research Ban Lifted
2018: US Patent 7279327 for the chimeric adaption of the naturally occurring animal SARS Coronavirus to become infectious to humans targeting lung epithelial cells is transferred from University of North Carolina to he US National Institute for Health (NIH) - who funded it in the first place.
2018 March 27: Peter Daszak and the Eco Health Alliance in 2018 submitted a proposal to DARPA to do gain of function research on SARS coronaviruses to insert a double CGG codon furin cleavage site in an optimal position into the coronavirus gene. COVID-19 has a double CGG codon furin cleavage site optimally positioned to infect humans. https://theintercept.com/2021/09/23/coronavirus-research-grant-darpa/
Let’s look at the big picture: A novel SARS coronavirus emerges in Wuhan with a novel cleavage site in it. We now have evidence that, in early 2018, they had pitched inserting novel cleavage sites into novel SARS-related viruses in their lab,” said Chan. “This definitely tips the scales for me. And I think it should do that for many other scientists too.”
https://www.documentcloud.org/documents/21066966-defuse-proposal - this is the Eco health alliance DARPA funding proposal.
Oh dear. That really nails it. DARPA confirms that Peter Daszak of the Eco Health Alliance submitted a proposal on 2018March27 to add a Double CGG codon furin cleavage site to SARS1. SARS CoV 2 has that furin cleavage site. In fact the double CGG codon Furin cleavage site is the main difference between Covid-19 and the Bat Coronavirus RaGT13. Fauci funded Wuhan through the Eco Health Alliance.
Here is Peter Daszak admitting that he and Ralph Baric made new forms of SARS in the lab
The Daily Mail said of this proposal - The most alarming aspect of the research plan revealed in the documents is a plan to search viral genetic databases for new types of 'furin cleavage sites' which help a virus attack a host. According to the proposal, 'high-risk' versions of these sites, once identified, would then be grafted onto SARS-like bat coronaviruses via genetic engineering. This revelation is alarming because SARS-CoV-2, the virus which causes COVID-19, has just such a furin cleavage site, which increases its power and deadliness, but a similar feature has never been observed in other SARS-like coronaviruses in nature.
Actually the double CGG codon Furin Cleavage site does not exist in ANY virus in nature. And this proposal nails Peter Daszak/ECO Health Allinace at the creator of SARS CoV 2 and Covid-19. which differs from the Bat Coronavirus RaTG13 only by the insertion of double CGG Codon Furin cleavage site and by other smaller deviations all of which are 3 or less base pairs (1 codon) long - https://dailyexpose.uk/2022/03/17/exhaustive-proof-moderna-made-covid-19/
2018: Shi Zhengli (batwoman) presents research at Shanghai Jiao Tong University on 14 Nov. 2018 entitled “Studies on Bat Coronavirus and its cross-species infection.” This presentation has since been deleted from the University website.
2019 March 28: Moderna files their final patent application for their gene therapy mRNA-1273 (amino acid chain) Covid-19 vaccine, 6 months before the outbreak of the disease.- https://www.modernatx.com/patents
US 10,703,789 filed January 12 2019
US 10,702,600 filed February 28 2020
US 10,577,403 filed June 12 2019
US 10,442,756 filed December 18 2017
US 10,266,485 filed June 11 2018
US 10,064,959 filed April 21 2017
US 9,868,692 filed July 27, 2017
The 2nd patent, filed on February 28 2020 was a continuation of an earlier patent application number 16/368,270 which was filed on March 28, 2019
2019August 7: Fort Detrick in Maryland is the centre of all US bio weapons production. On August 7th, 2019, its deadly germ research operations were abruptly shutdown following serious safety violations, in particular relating to the disposal of dangerous materials - https://en.wikipedia.org/wiki/Fort_Detrick
The CDC issued a Cease and Desist to Fort Detrick on 2019July15. The lab put all research on hold on August2 and was shut down on 2019August7 according to Fredericknewspost.com reported by Heather Mongilio - https://madisonarealymesupportgroup.com/2019/08/07/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/
https://www.military.com/daily-news/2019/11/24/cdc-inspection-findings-reveal-more-about-fort-detrick-research-suspension.html
The lab reopened partially in late November 2019 and fully reopened in April 2020. The Link has now been changed, the article has been suppressed.
https://www.fredericknewspost.com/news/health/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/article_767f3459-59c2-510f-9067-bb215db4396d.html
Link does not work for EU people any more. It worked when it was first posted!
2019: Summer deletion of Wuhan Institute of Virology Corona Virus data bank.
2019 October: Glen Beck discovers evidence that 10 hospitals in Wuhan had Covid-19 cases - https://100percentfedup.com/bombshell-glenn-beck-reveals-nih-and-moderna-worked-on-mrna-vaxx-together-before-pandemic/
2019: November: University of North Carolina, Moderna and NIH began the sequencing of the 1273 amino acid spike protein vaccine (from the Wuhan Hu1 template) a month before the outbreak officially occurred. (From the interview between Dr David Martin and Reiner Fullmich)
2019 November 12: Black and Vetch sends $369,511 to Labyrinth Global Health in Ukraine for " Covid-19 Research" before Covid-19 was known or named publicly..
2019: December 31 Wuhan Municipal Health Commission report discussing COVID-19 pneumonia - deleted.
2019: December31: WHO is informed of a pneumonia type outbreak in Wuhan.
https://odysee.com/@Corona-Ausschuss:3/Sitzung-60-Die-Zeit-ist-kein-flacher-Kreis-5-Martin
https://by-julietbonnay.com/2021/08/we-made-sars-patent-office-evidence-video/
https://www.davidmartin.world/wp-content/uploads/2021/01/The_Fauci_COVID-19_Dossier.pdf
https://www.algora.com/Algora_blog/2021/06/27/dr-peter-mccullough-whistleblowers-inside-cdc-claim-injections-have-already-killed-50000-americans
This timeline proves that before every new type of Coronavirus appeared and became a threat to the health of mankind, the nightmare team of Baric, Daszak and Zhengli funded by Fauci's NIAID and the NIH of Collins and the US government with more than 114 million dollars (see below for the breakdown), had developed the capability to make that new type of Coronavirus themselves. This is true of SARS Cov 1, of MERS and of SARS CoV 2 (Covid-19).
So it seems to the writer that Fauci's NIAID and the US Government, funded Baric and Daszak to make these bioweapons - possibly for legitimate national security reasons. But when the capability had been developed, then greed set in and a very profitable business model became visible. Furthermore a global reset political population control model also appeared. These two models were too appealing to too many powerful people. So the decisions were made to release these weapons not long after they were made. There is no question that SARS CoV 2 (causing Covid-19) is man made, because the virus has a double CGG codon Furin Cleavage site which does not appear in any natural virus. - https://dailyexpose.uk/2022/03/17/exhaustive-proof-moderna-made-covid-19/
There is no candidate for its creation that is not funded by the NIAID or the NIH or the US government. So this is a US government program. Hence Biden's instruction to his intelligence services to investigate the origins of Covid-19 resulted in the obvious lie that: WE DON'T KNOW. That one conclusion, is in itself a proof that the US intelligence services are behind the pandemic. Because they do know that it was man made. Indeed every reader of the Expose knows that. The chances of the US intelligence services being unaware of the existence of the Expose in circumstances where every Covid-19 stats department in the 5 eyes countries has responded to their articles by either stopping producing figures, or castigating department heads or changing the way figures are calculated or straight up rigging their figures, are Zero. So they are covering up. So they are guilty. Also the closure of Fort Detrick (the premier US bioweapons facility) due to a leak, in August, 2 months before the October 2019 infections in 10 hospitals in Wuhan, is far too close for comfort.
When you add to this the fact the Eugenicist Bill Gates and his foundation have been vaccine mad since 1999. You begin to see that this may not have been a legitimate national security endeavour from the start.
When you consider that Fauci's NIAID has been funding Baric since 1986, you see that these players are part of a long standing team.
When you consider how much money they have received from the US government, you see who really is managing this team.
When you consider the number of biolabs discovered in Ukraine, you see how seriously the US government takes bioweapons research.
When you consider that Moderna had all 7 of its vaccine patents filed 6 months before the outbreak of the disease, and has the double CGG codon cited in 5 of its patent applications dating from 2013, you realise that they are on the inside of this game and a part of the team (through Fauci presumably).
So we know it was man made. We know who funded its creation. We know who created it. We know who profited from it. We know who used it for political control. All that remains is to determine whether those who profited from it and funded it and sought control from it deliberately arranged for its release in order to realise those profits and that control. That is for the reader to decide.
What I will say is that the US funded Biolabs were not located in Ukraine in order to target Genetic Russians in my opinion. Because first of all I do not think mankind has that capability yet (thank God). And secondly the Russians developed their own vaccines denying their market to the nightmare team above. And thirdly even if a virus could be designed which preferentially targeted some aspects of a typical Russian genome, that would constitute a war crime against every nation. Because genetic Russians do not only live in Russia and are not only Russian citizens. They live all over the globe in large numbers in every country. Such a weapon would be a universal world war, the minute it was released. I think those labs were in Ukraine in order to further the globalist agenda. Perhaps when they released the next pathogen, they were going to blame it upon Russia, rather than upon China? Or maybe just admit the US did it. Whatever the globalists think will case the most damage to the system they are trying to destroy or should I say reset, in order to build back better.
US Government Funding for Peter Daszak and ECO Health Alliance
Government Department | Grant Value | Period |
DoD Department of Defense | $38,949,941.00 | 2013-2020 |
HHS Health & Human Services (includes NIH and CDC) | $13,023,168.00 | 2007-2020 |
National Science Foundation | $2,590,418.00 | 2006-2020 |
USAID US Agency for International Development | $2,499,147.00 | 2013-2016 |
DHS Department of Homeland Security | $2,272,813 | 2016-2019 |
DoC Department of Commerce | $1,241,933.00 | 2006-2010 |
USDA US Department of Agriculture | $646,701.00 | 2007-2009 |
DoI Department of the Interior | $267,062.00 | 2004-2014 |
Total | $61,491,183 | 2004-2020 |
US government Funding of the Wuhan Institute of Virology
The Wuhan lab got a $3.7 million grant from the US government approved by Obama running over 4 years from 2015 to 2019. - https://www.snopes.com/fact-check/obama-admin-wuhan-lab-grant/
Fauci also gave them $3.7 million from the NIAID (National Institute of Allergy and Infectious Diseases) - In 2019, with the backing of NIAID, the National Institutes of Health committed $3.7 million over six years for research that included some gain-of-function work. The program followed another $3.7 million, 5-year project for collecting and studying bat coronaviruses, which ended in 2019, bringing the total to $7.4 million. - https://www.newsweek.com/dr-fauci-backed-controversial-wuhan-lab-millions-us-dollars-risky-coronavirus-research-1500741
"The controversy was such that it led to a Congressional moratorium on chimeric research in the USA. At which point, Dr. Antonio Fauci diverted 3.7 Million U.S. Dollars of U.S. Taxpayer monies to the Wuhan Institute of Virology to continue the research.
Rudy Giuliani, legal counsel to U. S. President Donald Trump, and former Mayor of New York city, recently demanded an explanation from Dr. Fauci for this transfer, which violated U.S. Laws against funding the research.
In addition to the research done at Chapel Hill, North Carolina, the specific kind of research into Coronaviruses as possible biological warfare agents, was being done at Fort Detrick, Maryland, USA, by the U. S. Army, which has a Level 3 and 4 Biowarfare Lab at the military base. This lab was cited by the U.S. Center for Disease Control and Prevention (CDC) in July, 2019 for failure to maintain proper containment standards"
- https://www.fromrome.info/tag/fort-detrick/
NIAID and NIGMS Funding of Ralph S. Baric at the University of North Carolina Chapel Hill
2001 May1: https://grantome.com/grant/NIH/R01-GM063228-03
$1,007,735 over 4 years from 2001 to 2004
NIGMS (National Institute of General Medical Sicences)
Reverse Genetics with A Coronavirus Infectious Construct
Baric, Ralph S.
University of North Carolina Chapel Hill
2004 February15: https://grantome.com/grant/NIH/R01-AI059136-01
$1.402,316 million over 5 years from 2004 to 2008.
Reverse Genetics
Baric, Ralph S.
University of North Carolina Chapel Hill
Aim 1, we will develop a full length SARS cDNA clone and compare the phenotype of rescued molecular cloned viruses with wildtype using biochemical assays and macaque challenge experiments.
Aim 2, we will develop high titer SARS single hit replicons for use as expression vectors and vaccines.
Aim 3, we will select for SARS host range mutants that replicate in murine (mouse and rat) cells, identify the mechanism of SARS cross species transmission using reverse genetic approaches and evaluate the pathogenicity of these viruses in rodents and non human primates. The goal of this application is to establish genetic control over the SARS genome and provide uniform reagents that will be used by other groups throughout the country.
2004 May15: https://grantome.com/grant/NIH/R01-AI061819-01
$367,042 for 2004
Remodeling SARS Coronavirus Genome Regulatory Networks
Baric, Ralph S.
University of North Carolina Chapel Hill
2005 May1: https://grantome.com/grant/NIH/P01-AI059443-01A1
$1,676,513 for 2005
Developing Vaccine Candidates for the SARS Coronavirus
Baric, Ralph S.
University of North Carolina Chapel Hill
Total NIAID funding for Ralph Baric at University of North Carolina was $46,958,414. (https://grantome.com all grants to Baric, Ralph)
Year | Grant |
2000 | 201,232 |
2001 | 455,041 |
2002 | 253,321 |
2003 | 902,719 |
2004 | 1,628,345 |
2005 | 3,277,688 |
2006 | 3,262,315 |
2007 | 3,315,802 |
2008 | 3,539,843 |
2009 | 4,273,858 |
2010 | 1,877,793 |
2011 | 1,703,273 |
2012 | 6,871,244 |
2013 | 8,985,633 |
2014 | 1,404,641 |
2015 | 222,637 |
2016 | 1,368,161 |
2017 | 3,414,868 |
Total | 46,958,414 |
Dr David Martin - https://www.davidmartin.world/wp-content/uploads/2021/01/The_Fauci_COVID-19_Dossier.pdf
(not entirely accurate)
https://21a86421-c3e0-461b-83c2-cfe4628dfadc.filesusr.com/ugd/659775_6f632cc8d75d4d8c8b90cc749262f4b4.pdf
Richard Flemming (comprehensive).
www.lordswitnesses.net/downloads/Flemming.pdf
Richard Flemming (comprehensive).
https://www.webmd.com/lung/news/20030411/sars-timeline-of-outbreak
(detailed)
So the US government funded Peter Daszak's ECO Health Alliance to the tune of 61,491, 183 dollars. It directly or indirectly funded the Wuhan Institute of Virology to the tune of 7.4 million dollars and the NIAID (with a million or so from the NIGMS) funded Ralph Baric to the tune of 46, 958,414 dollars. This totals more than 114 million dollars in the period from 2000 to 2020 to make new Coronaviruses which are infectious to humans.
Q: What kind of a species succeeds in making the common cold more dangerous, but fails to find a cure for it?
Q: What kind of a species makes and enforces a vaccine for a disease which is more lethal than the disease itself?
A: A species whose leadership is genocidal and needs to be removed if we are to survive much longer.
Peter Daszak's DARPA proposal to...
Search viral genetic databases for new types of 'furin cleavage sites' which help a virus attack a host. According to the proposal, 'high-risk' versions of these sites, once identified, would then be grafted onto SARS-like bat coronaviruses via genetic engineering.
Is precisely how SARS-CoV-2 was made (essentially the double CGG codon PRRAR Furin Cleavage site was inserted into the RaTG13 Bat Coronavirus). It was man made, because nature does not have a double CGG codon furin cleavage site in any virus
The way man made it was to add that cleavage site as Daszak proposed. DARPA rejected his proposal quite rightly (under Trump), because it is a really dangerous thing to do as we have now all discovered. But Daszak had other sources of funding and the proposal became a reality This is a lot more evidence and detail for Daszak's role in the creation of Covid-19 in the website https://eco-healthalliance.org/ I do recommend looking at it. It is written by a victim of Covid-19 who has done a massive amount of research. He discloses that Daszak introduced Ralph Baric to Shi Zheng Li and postulates that Daszak orchestrated the whole show. He reveals that Daszak was a fact checker at Facebook for a while! He represents that his father was a Nazi death camp executioner in Ukraine during WW2. The author of the site is embittered against Daszak and the site is a Daszak take down. But the passion he feels has driven him to do a lot of interesting research - which should be seen.
Ironically, the way I proved that Covid-19 was man made was to do precisely what Peter Daszak wanted DARPA to pay him to do, not for any human targeting Furin Cleavage site but for the particular embodiment of it found in SARS2 (the one that Daszak and the nightmare team eventually settled on I suspect). .When I found that no natural virus had that embodiment at all, I knew that Covid-19 was man made. Having read the DARPA proposal I believe that man was Peter Daszak, the guy who organised the letter to the Lancet from 27 scientists organised by Peter Daszak who said:
"We stand together to strongly condemn conspiracy theories suggesting that COVID-19 does not have a natural origin."
Well, in my book they are none of them scientists. Because science is about making hypotheses from evidence and formulating theories to be tested by experimentation. It is not about strongly condemning those who follow the scientific method and slandering their efforts using derogatory language. These 27 are now shown up for what they truly are. I challenge all 27 of them to show me a virus which occurred in nature before 2019 which has a double CGG codon Furin Cleavage site (PRRAR). If they cannot find one then retract their name from that self condemning letter, and return to being what they were trained to be..
Allow me to explain something to the 27 of Daszak. When two scientists get together and formulate a new scientific theory by discussion, that is a conspiracy theory, a theory arising our of their 'breathing- together'. If you ban conspiracy theories from science, then any theory which results from any meeting between scientists must be thrown out. That would abolish most of science. Because even when a scientist by himself formulates a theory as a result of a moment of inspiration, that theory will have had seeds planted through many preceding moments of conspiration. In short, if you condemn conspiracy theories, then you are a 21st century politician, not a scientist. You may very well be offered a nice lucrative job as a fact checker at facebook, youtube or twitter, however. .
It is obvious that Joe Biden is not the real president of the United States. He does not have the capability or the authority to answer a question from a journalist in his own words. Indeed when he does appear to speak from his own originality, about Putin or about going to Ukraine, for example, he is instantly contradicted by 'his own' administration. One can argue that he is merely delegating his presidential authority to those whom he deems fit to wield it. But if he is not permitted to choose a journalist's question by himself and if he is not permitted to visit countries he wishes to visit, then neither will he be permitted to delegate his authority by himself. In truth this is an argument that I do not really have to make because the majority of Americans do not believe that Biden is running the country already
So he is not the President of the United States. He is the front man, in fact, he is the fall guy for the real president. That of course is the largest democratic fraud it is possible to have in a presidential democracy. A fraud perpetrated by those who represent that the greatest threat to 'Our democracy' is the possibility that their electoral opponents might get more votes than them, or worse still that they might get more counted votes than them. Whereas of course that is not a threat to democracy. That is the very definition of democracy. A definition which they seek to corrupt whilst falsely representing that they are seeking to preserve its integrity as a cover story for their corruption of it, as a transparently false narrative that hides their dictatorial ambition.
It is always difficult to get to see the full extent of a sophisticated fraud in time. It is hard to get to the final deception in the scheme before it is too late. One normally only arrives there years after the deception is completed. But I hate being conned and I hate seeing other people being conned. So here is my attempt to reveal the true 46th president of the United States and the true extent of the fraud which I believe he is presiding over. Whoever the 46th is, and it most certainly is not Biden, the Republicans should have started impeachment proceedings against him a long time ago. But regrettably, they appear to be either in on the fraud, or hopelessly naive.
The fraud is as monumental as it is brilliant. If you thought that Johnny Depp was versatile or Robert Downey Junior was convincing or Julia Roberts was expressive or Leonardo Di Caprio was popular - think again. Because those guys have nothing on this Master of Deception. If Inception had too many dream layers for you to follow, then be prepared to be left at the train station a second time, because the layers of deception in this nightmare give Chris Nolan's Epic a run for its complexity.
Here are the 7 pieces of evidence from which I will start my arguments...
1. Barack famously said of Joe Biden: Never under estimate Joe's ability to F things up.
2. The first thing Obama and Biden both did when they came into office was to remove the bust of Winston Churchill from the Whitehouse. A symbolic gesture yes - but more than that - it is the globalist agenda to end the supremacy of the US-UK world power - by any and by every means possible.
3 In a great Interview with Stephen Colbert, Barack said: And I used to say, ‘You know what, if I could make an arrangement where I had a stand-in, a front man or a front woman and they had an earpiece in and I was just in my basement with my sweats looking through the stuff, and I could sort of deliver the lines, but somebody else was doing all the talking and ceremony, I would be fine with that,'” he said.
4. Everyone ignored a sad and lost Joe Biden when Obama visited him at the Whitehouse on 2022April5. All the focus was on Obama. Nancy Pelosi went as far as to kiss Obama's hand as if he was the Messiah or the Pope
5. Obama joked at his recent visit to the Whitehouse on April 5th, that he was still the President and Joe Biden was still his VP
6. The foreign policy of Biden is described by Nikki Haley as Obama2. The sexual orientation policies of Biden and Obama are indistinguishably heterophobic, masculophobic, feminophobic and genderphobic. The aggressive pursuit of what is called racial equity but is nothing short of pro African American prejudice, is common to both Administrations. This is not surprising from Obama, who is part African American. But it is surprising from Biden who is Irish American.
7. The defining characteristic of Obama's presidency was the partisan corruption of every organ of state from the parks department to the IRS, to become an electoral campaign office for the democrats.
Obama was and is without doubt the most brilliant politician of his generation. He preached unity with the fervour of Dr. Martin Luther King but he sowed partisan division with the alacrity of a horseman of the apocalypse.
And having split America in two, red and blue, his party, and the media they control, blamed their political opponent Donald Trump for dividing the nation with his words, which nation Barack himself had already with his actions, whilst preaching unity with his words. The difference between Trump and Obama was candour. It was sincerity. With Trump, the words came out of his mouth before they had left his brain, because he was and he is a business executive. He is not a politician. Whereas Obama was the consummate politician. Every word he spoke was crafted by his internal political processing until to become the opposite of his true intentions before it left his mouth. So that he destroys democracy in the name of saving it and he propagates disinformation in the name of curtailing its spread
To a Globalist controlled Obama administration whether fronted by Obama himself, or fronted by Biden. the purpose of the US Military is not to defend the United States. It is not to defend freedom. It is not to defend democracy. No, no. Get real! It is to defend the Democratic party and to attack Republicans and their principles. And if a solider or sailor or airman or marine is not prepared to submit to left wing indoctrination and genetic vaccine corruption in their workplace then they can take their lethal tax payer funded expertise somewhere else..
To a Globalist controlled Obama administration and sadly actually to most politicians these days, the purpose of healthcare is not to cure the sick. No, no. Get real! It is to make themselves more electable, and to get more money into a system which can benefit themselves and their electoral chances through their mates.
To a Globalist controlled Obama administration, the purpose of the FBI is not to investigate criminals. No, no. Get real! It is to persecute republicans, especially those who have the temerity to campaign or merely to stand against democrats. Those ones are to be prosecuted into bankruptcy or incarceration or both. Not merely to punish them for their insubordination. But to serve as a warning to every American who even thinks about campaigning for a republican or standing as a republican. To force such a misguided individual to accept that he will make himself a target for political persecution, prosecution and incarceration for the rest of his life (under a democratic administration). To make Obama's opponents understand fully that they will never be able to provide for their children or spouses or grandparents again. To engender in all republican campaigners, especially presidential campaigners, but also electoral fraud protestors, the same fear that the opponents of Putin feel in Russia and the opponents of Xi feel in China.
To a Globalist controlled Obama administration, the purpose of a border is not to keep out aliens or to protect the integrity of the population from gang members, drug traffickers, people traffickers, rapists and murders. No, no. Get real. It is to stuff the ballot box with the votes of economically disadvantaged immigrants whom they can buy really cheaply with tax payers money. This is why they want them bussed or better still flown into republican areas. They would parachute them into those areas on election night if they thought it would generate more votes and swing the state.
But all of that, as bad and as corrupt and as insincere as it all is, still misses the big picture. Which is that the actions of Obama 46 and Obama 44, I seek to prove, show him to be an anti American traitor whose job is to destroy the military capability, the energy independence, the family cohesiveness, the exemplary racial integration, the technical superiority and the overall economy of the US, in order to make way for the new kids on the block, his controllers, the globalists, who wish to put us all under a Chinese style economic dictatorship within a Russian style police state, with no freedom of speech, no (living) political opposition and plenty of forced labour camps for anybody who mistakenly believes that they have some semblance of human rights.
Yet you will hear none of this from his mouth. For never in the history of American politics has there been a greater gap between rhetoric and reality than with Barack Obama. He is the consummate politician. He will promise you the earth, the moon and the stars themselves and then fail to deliver even a fragment of an asteroid when he gets his hand upon power. What he will succeed in delivering is the precise opposite of what he has promised and you will thank him for it and you will beg him for more. He is that good. And he has that much disdain for your intellectual capability.
He will sell you slavery as freedom
He will sell you equity as justice
He will sell you dictatorship as democracy
He will sell you censorship as freedom of speech
He will sell you exclusion as inclusion
He will sell you the destruction of the sex organs of your children as gender affirmation.
He will sell you Klaus Swchwab as Jesus Christ and you will buy it.
Just as Satan himself sold Eve death as divine status.
The purpose of this article is to stop him in time, before he, as a recipient of the Nobel peace prize, and on behalf of the globalists, sells you nuclear destruction as the only way to bring about peace. Putin is already on board with the globalists in this disaster movie. For Lavrov revealed on 2022April13 that Russia seeks to end the US dominated world order, and that happens to be the number one goal of the globalists and their new world order.
Yes, the visionary from Chicago has the tongue of an angel, but the heart of a demon and that is what makes him so appealing and yet so dangerous at the same time. .
Here then is the brilliance of his plan. He predicts that Joe Biden will screw everything up. Then his party rigs an election to get Joe Biden into power. Incidentally here is a simple proof that the 2020 presidential election was rigged. I mean the most obvious proof is that the democrat controlled mainstream media, do not permit discussion of the subject. That's it. That's the proof. Likewise the persecution of the January 6th electoral fraud capitol hill sit in protestors is further proof. If the Democrats had nothing to fear from such discussion or such protests, they would not protect themselves from them. But they do protect themselves. So they do have something to fear. And the only thing they could be fearing is that their rigged election will be exposed and overturned. Well lap it up you sick control freaks. Anyone who understands human nature knows you rigged it.
Joe Biden said: "We have put together, I think, the most extensive and inclusive voter fraud organization in the history of American politics," https://twitter.com/i/status/1320117044612943872
When a politician gets dementia as Joe Biden has, he cannot control with his will, the words that come out of his mouth. So he is less able to lie. So he starts telling the truth. Dementia is like a truth serum to a politician. Lying is an intelligence intensive operation. Biden, today, lacks the capability to do it. So his handlers more recently are feeding him lies in the first place to ensure that he cannot tell the truth again, like he did about the voter fraud.
The Democrats tried to change election law through congress and failed. They could not change it through the state legislatures in the swing states because they are republican. So they unconstitutionally changed election law through corrupt state officials and a corrupted judiciary. This created the absurd circumstance where you cannot do anything in the US without personal ID - except vote. The Democrats made 600 recent voting law changes many of which were unconstitutional to state law. So the democrats certainly cheated with election law changes. Therefore one is pushed toward the conclusion that they cheated also with vote counting.
Biden in 2020 won 527 counties in the US with 81 million Votes. Obama in 2012 won 689 counties with 65 million votes.
So in 2020 Biden got 16 million more votes than Obama got in 2012 having won 162 less counties. He got 25% more votes from 25% less won counties. The US population increases by 0.72% per year. So over 8 years it increases by 5.76% not 25%. There may have been significant movement from the countryside into the cities. But people who change their address do not generally change their politics as a result.
So all other things being equal Biden's figures are not credible. But all other things were not equal. Biden did no campaigning, had absolutely no memorable election slogan and could not string 2 sentences together without making a gaffe and has very little if any Charisma. Whereas Obama did exhaustive campaigning with the wonderful campaign slogan YES WE CAN and is dripping with Charisma and is the best political speaker of his generation. So the chances of zero charisma, zero campaigning, no election slogan, mediocre speaker Biden outperforming charisma loaded, YES WE CAN, exhaustive campaigning, wonder speaker Obama by 25% from 25% less won counties are ZERO.
One could argue that the huge improvement in the democratic vote was the result of hatred of Trump which was not present when Obama beat Romney in 2012.
But against that we have 162 less counties won by Biden than Obama and hatred of Trump is NOT county specific in swing counties. Hatred of Trump would produce a more uniform increase for Biden. So had Trump hatred been the driving force Biden would have won a similar number of counties to Obama.
Also Obama was the president for 8 years and Biden was his vice president. That was because Obama was in 2098 and 2012, and is still today, MORE popular than Biden not LESS popular.
Finally the total number of votes cast in 2020 was 155.5 million. Whereas in 2016 it was 128.8 million and in 2012 it was 126.8 million and in 2008 it was 129.4 million. You would expect 3 million more votes every 4 years from normal population growth of 0.72% per year. So there should have been perhaps 135 million votes tops in 2020. 2008 was Obama's first term and he was really really popular. Sure all the postal ballots due to Covid19 would have increased the vote - but not by 20 million. I would suggest that at least half of that, at least 10 million votes, were fabricated to get Biden above Trump.
What I hate most about current affairs programs, even those run by experienced news presenters like Megyn Kelly or experienced politicians like Nigel Farage (both of whom I am actually a fan of). is that they are all complicit in the most obvious pretence that Biden is the 46th president. Here is Farage getting it wrong and calling for the 25th on Biden.
What Farage should be doing is calling for the 22nd on Obama. You will achieve nothing by removing Biden. HE IS NOT THE PRESIDENT. Why do these people pretend that he is?
Psaki was Obama's press secretary. Now she is Biden's press spokesperson and handler. Biden, of his own initiative, told a reporter that he was ready to go to Ukraine. Within hours Obama said NO through Psaki. The closest Newsmax could get to the truth about this was: Who is calling the shots here? It is not hard to see the answer, Here is the maths involved
44 + 2 = 46 QED.
Here is a wonderful twitter video of Jen Psaki telling Joy Behar on 2022January23, how much she loves working for President Obam...Biden - in the present tense!
Psaki had actually spilt the beans earlier in April 2021
“How involved is former President Obama and first lady Obama in the Biden-Harris administration?” Asked Chris Johnson of the Washington Blade of Psaki in April 2021..
“They’re not just former colleagues,” Psaki replied, “I guess you’d call them as president and vice president, but they also remain close friends,
and they talk regularly about a range of issues from policy issues to bouncing ideas off of each other to their families. So, they are in close touch but we just don’t read out those specific calls. We keep them private.”
Yer, I bet they keep them private. Otherwise their presidential fraud would be exposed. Obama was never anybody's vice president was he? That is a further admission that Obama is the 46th.
So to impeach Obama and Biden together all one has to do is get hold of those calls. For this is a conspiracy to defraud the US electorate and of course a breaching of both of their oaths of office to uphold the constitution of the United States, and Jen Psaki has admitted as much.
To be frank. One does not have to be a Woodward or a Bernstein (of circa 1974) to see this Presidential Fraud of far greater consequence than Watergate. This is OBAMAGATE. And it will lead to WW3 if it is not fixed Pronto. For that is what the globalist handlers of Obama 46 want. And If America wants to either avoid or as an immeasurably worse option, not get destroyed by, a globalist orchestrated WW3 then Obama 46 needs to go and he needs to go now.
So having rigged the election for Biden, guess what happens? Biden starts to F things up just as Obama predicted. But Obama is no prophet. It is Obama himself who is screwing things up and hiding behind Biden. Obama is now in the perfect position. He can act with impunity. He can do whatever he wants and all the blame for his actions goes to doddery old Biden, the perfect fall guy. What a plan! Obama no longer needs to care if his policies are popular. He can just do what he and what his globalist handlers want and blame a demented President for things which he has absolutely no control over whatsoever. What happened on 2022 April 5, was that the wizard came out from hiding behind the curtain of a demented Biden.
So there is a fraudulent election. Then there is a fraudulent president, who acts the part, but has no presidential authority even to use his own words. Then Obama, the true president, is himself a treasonous fraud having ceded presidential authority to the globalists, knowing that they will use that authority to destroy the financial and military power, the racial harmony, the family authority, the civil peace and the international prestige of America. Furthermore he is a 3rd term 22nd amendment fraud quite obviously. And Biden was a 25th amendment fraud the minute he swore his oath of office because he at that moment did not have the mental capability to make presidential decisions and certainly not to be commander in chief of the US military.. In a poll conducted by Trafalgar in July 2021, 8 in 10 Republicans, 6 in 10 Independents and 1 in 3 Democrats thought that Joe Biden was not running the country. OK so that makes a 5 layer fraud. About as many layers as Inception. So perhaps the reader will not be left behind on the platform with this one?
God's law is that whatever a man or indeed a group of men is sowing this they will also reap. Or as Sir Isaac Newton put it: Action and reaction are equal and opposite. So rather than false republicans and naive journalists talking about impeaching the false president, Joe Biden under the 25th amendment. How about true republicans actually impeaching the true president, Barack Obama under the 22nd. Impeaching Biden is pointless. He is not the president. Even if they fail to get enough votes to impeach. It is still the right thing to do. It is like Lord Justice Denning said in the UK. However high you are in life, the law is above you.
On the one hand you have a group of perhaps 2,000 men, dying without healthcare, bombed into the stone age, starved to emaciation, branded by the Russians and some mainstream and even some alternative media as Nazis, who refuse to leave the office, and continue to defend their country and their city 24/7, to their dying breath.. On the other hand you have the Whitehall civil servants, perhaps 474,020 of them, who deny their country healthcare by failing to provide PPE other than through a select group of large corporations which typically in these situations pay covert bribes to powerful public sector people in order to become their preferred suppliers. Indeed that is generally the reason why they are preferred so much. But these civil servants refuse even to turn up at the office.
Which one of these two groups would you say is doing the greater service for the British people?
If I personally had the power to liberate them I would do it. Notwithstanding the fact that I had at least one of my relatives killed in a Nazi concentration camp by real Nazis. But sadly all I have to support them with are my words.
But words are the one thing that opponents of the present Russian regime are denied. So It is my great pleasure to use my freedom of speech in this publication on behalf of every silenced Russian Journalist and true Russian Patriot and true Ukrainian patriot just as I have done on behalf of those denied a voice over gene poisoning vaccines and US election fraud and the perversion of children for the sexual gratification of immoral adults. So many groups in this world are denied a voice. Regrettably I do not have the billions or the credibility to rescue Twitter from the globalists and may God bless the one who has. But The Expose gives me the richness of self expression which is what the Asovstallers are fighting for and what we in the West all too often take for granted.
The civil servants, famously described by Sir Winston as no longer being civil and no longer being servants, are serving themselves first, whether it be in providing healthcare for the sick and the dying in this country or in providing Visa's for those fleeing death and destruction in Ukraine Whereas the Asovstallers are serving their families, their country, Poland, Romania, the Baltic states, the EU, the Scandinavians, the Americans and the British & Irish both of whom have been threatened with a swift despatch into Davy Jones' radioactive locker by a Russian supercavitating nuclear propelled torpedo with a large nuclear warhead.
They serve us by delaying, thwarting and stalling the Russian offensive in Ukraine, which buys us time to better prepare our defences against charming Russian threats to annihilate all of us by various machiavellian technologies they have devised in their spare time for that very purpose.
To me, the defining characteristics of Nazis were and are
1. Blitzkrieg land grabs
2. Forced relocations and Concentration camps for those who oppose them politically or militarily or philosophically or religiously, in fact in an way whatsoever
3. Civilian reprisals for those who inflict military damage to their war machine
4. Total control of state information
5. The invention of new types of intercontinental missiles (V1, V2 etc.)
6. The desire to become the new World Super Power.
7. The belief that they are the master race and incessant threats to all races inferior to them - which is all other races.
Translating that into Russian using Rouble Translate we get...
1. Blitzkrieg land grabs in Georgia and Ukraine
2. Forced relocations, filtration and labour camps for those who oppose them politically or militarily or philosophically or religiously, in fact in an way whatsoever
3. Kiev was bombed in civilian reprisal for sinking the Moskva.
4. Total control of state information
5. The invention of new types of intercontinental missiles (Hypersonic nuclear missiles and Supercavitating nuclear torpedos)
6. The Special Military Operation in Ukraine is designed to End US dominance in the words of Sergei Lavrov, the Russian Foreign Minister. So NOT merely to demilitarize Ukraine.
7. Dmitry Rogozin, the head of the Russian space agency, has warned that Russia could destroy NATO in 30 minutes with nuclear weapons in his Telegram channel.
So how does one behave like a Hypersonic Hitler or a Supersonic Stalin and get away with it in the 21st century?
One uses the tried a tested method of proactive hypocrisy, pre-emptive accusation, accusatory hypocrisy. One accuses one's enemy of being or doing what one is about to be or to do oneself. Because as Sir Winston said: A lie gets half way around the world before the truth gets the chance to put its pants on. So if you want to get away with a Nazi Blitzkrieg without being called a Nazi, then you must first accuse your intended victims of being Nazis Or better still you frame your entire war effort as an attack on Naziism. Then you can carry out your Nazi imperialism with impunity. .
The democrats in the US do this with 'Our democracy', which is of course their dictatorship. They attack democracy by rigging elections in every way imaginable, from media control to election law control to vote counting control to ballot harvesting with 2000 mules, to persecuting prosecuting and harassing opposing political campaigners candidates and presidents etc. But they do it under the cover narrative that they are defending democracy - which cover is designed to wrong foot their opponents..
Likewise Putin conducts a Nazi Blitzkrieg against Ukraine under the cover narrative that he is liberating Ukraine from a Nazi sympathising regime. It is the same technique from the same demonic playbook.
Bill Gates and Tony Fauci are masters at accusatory hypocrisy. They pose as saviours from a pandemic that they themselves funded. They force us to receive therapies that they funded or created, which are actually more lethal than the pandemic itself. The real disease here is the desire for power of the bad actors behind the pandemic and the vaccines. The pandemic and the vaccines are merely devices to provide them with the power they crave.
No man has a greater love than this, that he lay down his life for his friends, is the motto of my Oxford college and were Jesus' words at John 15:13.
Well the Asovstallers went one better than that. They laid down and are still laying down their lives, not merely for their friends, but actually for people who call them Nazis.
Nazis who have a greater love for people in this country than any Whitehall Mandarin can presently demonstrate from his armchair at home.
I would encourage the government to rescue these steel hearted lovers of freedom and give them all jobs in Whitehall.
Snowden Feb18: This possibility is frankly so terrible to me it is difficult to even contemplate. I still remember red scars on the streets of Sarajevo, the "Sarajevska ruža" remembering those killed by mortar fire.
Kyiv is bigger than Sarajevo. Than Grozny. Than Fallujah.
Just unthinkable.
Snowden Feb 27: I'm not suspended from the ceiling above a barrel of acid by a rope that burns a little faster every time I tweet, you concern-trolling ghouls. I've just lost any confidence I had that sharing my thinking on this particular topic continues to be useful, because I called it wrong.
Since Feb27, Snowden has made no further tweets about Ukraine.
For fear of stating the obvious - The longer the war in Ukraine carries on, the greater the chance is of it escalating into WW3. Whilst we must support the right of any country to defend itself against being colonized by a larger federation of nations, especially since Britain used to be such an aggressor itself. And especially since the UK the US and Ironically Russia too are bound by the 1994December5 Budapest Memorandum to defend Ukraine in return for their agreeing to give up their nuclear weapons (they used to be the 3rd largest nuclear power in the world), the first two paragraphs of which agreement state.
1. The Russian Federation, the United Kingdom of Great Britain and Northern Ireland and the United States of America reaffirm their commitment to Ukraine, in accordance with the principles of the Final Act of the Conference on Security and Cooperation in Europe, to respect the independence and sovereignty and the existing borders of Ukraine.
2. The Russian Federation, the United Kingdom of Great Britain and Northern Ireland and the United States of America reaffirm their obligation to refrain from the threat or use of force against the territorial integrity or political independence of Ukraine, and that none of their weapons will ever be used against Ukraine except in self-defence or otherwise in accordance with the Charter of the United Nations.
We are now in a situation where Russia has broken their 1994 commitments completely. Whereas the US and UK are keeping their commitments under the memo. But we must all remember that the purpose of the 1994 memorandum was to avoid a nuclear war involving Ukrainian nukes. It was not to risk a nuclear war over Ukraine!
So rather than sanctioning Russian oligarchs and Russian sports personalities and in particular Russian sports oligarchs whilst they are trying to broker peace deals, we should be building bridges to Putin through these people. Because the 1994 memo also pledges that all sides would keep in close communication. In the nuclear age this is critically important. We cannot afford to have bad relations with Putin however far apart we may be.
What is needed here is a Trump like character to have a man to man with Putin, and treat him with the respect he deserves for doing a really good job on the Russian economy. and for returning Russia to Super power status. To be frank, he needs recognition. He needs an Oscar from the Academy of Western Nations and what we gave him was a slap in the face.
Putin said that the only reason the US had any interest in relations with Moscow was that Russia was the only country that could destroy America in half an hour or less. Those are the words of a man with absurdly low self esteem. There are many, many reasons to have good relations with Russia. They are fantastically competent technologically and very very creative and super logical people. They are brilliant strategists. The worst thing we can do is to demonize them.
If we exclude him, he will only become more resentful. And wars, for all the meaningless justifications that are adduced on their behalf (breathing space, buffer zone etc.) are really about pride, ambition, greed, fear and all the other human emotions in the leaders of the warring parties. They are no different and no less destructive than an argument with ones better half. Such arguments are about emotion, about feeling valued or appreciated or wanted, or loved, or important. I know because I have lost many of those arguments by mistakenly believing they were about the subject matter of the argument.
Vladimir Putin is a resourceful human being as can be seen from his gymnastic lover. We need to be equally resourceful and equally gymnastic in our efforts to include him, nay even to woo him. Because there is no alternative. And he knows there is no alternative.
But we have done the exact opposite with him and he has reacted badly to our excluding him and treating him like the poor relative at the big boys power game. In that sense his Nazi behaviour is partly our fault. We cannot ask him to modify his behaviour if we are not prepared to modify our own behaviour. There is a real sense in which the worse he does in Ukraine, the less stable the world becomes.
Putin seeks acceptance. We denied him entry into the club. So he gate crashed the club. If we now succeed in throwing him out of the part of the club which he gate crashed, he may react by destroying the entire club. That is actually what the globalists want. So that they can build back better afterwards. But it is not what any human being with a heart or a conscience wants - including Putin.
So I would recommend the following deal: Release the Asovstallers and permit grain shipments from Odessa for the 3rd world, and in return we lift sanctions on all Russian sports people and oligarchs. We sanction the administration but not any old high profile Russian person. We build a bridge with our humanity. We make an offer of friendship. We start to include him. We offer him the opportunity to do something heroic for the 3rd world. We treat him with dignity that his power and might deserve. This is a difficult and testing situation. But the solution is more emotional than it is strategic or tactical I believe.
Even now, offering Russia to join NATO if they leave Ukraine would be a good idea in my humble opinion. Because NATO cannot afford to be enemies with Russia and neither can Russia afford to be enemies with NATO. Finland and Sweden are thinking of joining NATO and this has been billed as a great victory against Putin. I think it is a great disaster for world security. The club bouncer having rejected Putin is now admitting two women (seen that a few times before). How does that help calm things down?
How about this scenario: Let's invite every single country in the whole world to join NATO except Russia shall we? Because that now appears to be NATO's purpose. It has morphed into a club designed to exclude antagonise and alienate a nuclear super power. How does that make the world a safer place?
So here is my final suggestion. NATO cannot save Ukraine. But destroying NATO just might save it and the West along with it. I am not surprised that Putin wants Ukraine to be excluded from NATO like he is. Somebody has to keep the guy company as he hangs around outside the club!
I do not like gangs and to misquote Groucho Marx: I do not want to be a member of a club which would not have Russia as a member,.
Here in the West politicians bend over backwards to be inclusive to every group of people who might feel excluded. Every group, that is, except Russians, who are today excluded not only from NATO but from everything else the West has to offer. Yes, our response to their launching a war because they are excluded from NATO, has been to exclude them from everything else we have to offer as well.
The reason the West legislates inclusivity is to prevent the alienation of parts of society from the mainstream. Because such alienation can be damaging to society. Why then can we not apply the same principle to our nuclear neighbour Russia? NATO has become an excluding anachronism which should have been knocked down with the Berlin wall. This exclusion has in my opinion lead us to the war in Ukraine. If we are not careful it will lead us further into WW3 which will be between NATO and Russia,
So here is my suggestion for avoiding a war between NATO and Russia. Abolish NATO, Then there will be no WW3.. NATO is nuclear apartheid. Which is obviously far more dangerous and reckless than racial apartheid
Blacks today have the same rights to economic and social prosperity as whites. Should Russians not have the same rights to nuclear security as Westerners?
It is that insecurity which has lead to the Kinzhal Hypersonic nuclear missile and the Poseidon nuclear torpedo. These are not the creations of a nation which feels secure!
Really we have two choices here: Invite Russia to join NATO or abolish that Apartheid Anachronism if no invite is possible.
We should trust each individual NATO member to do the right thing for global and national security as they see it, without tying their hands in a centralised agreement. Because events are beginning to prove that...
The greatest threat to transatlantic security is NATO
The greatest threat to European prosperity is the EU
The greatest threat to world health is the WHO
And the greatest threat to mankind is the centralisation of power and the globalists who are trying to engineer that centralisation.
Your mission, should you choose to accept it, is to break in to the most secure facility in this world. It is to break through every form of obfuscation that has prevented you from finding said facility. Then you must break through every wall of deception within the facility itself, that prevents you from reaching the inner sanctuary, the citadel, the central tower of the castle. This is not a James Bond movie. The mission is not to blow up the sanctuary. It is more of an Indiana Jones movie. The mission is to see what the owners of the castle have been hiding from you for your entire life. It is to see who they are, who you are and what the real power game presently being played for your life is all about.
Your mission is to find the courage and the confidence and a sufficient love for the truth to take the red pill, knowing that doing so may damage your progress as measured by all the false metrics that the owners of the castle use to reward the peasants whom they rule over. Your financial social professional or political status may be compromised, and you will certainly lose your social media status if you speak about what you are about to see!
Mind you that is better than being forced to drink Hemlock or sentenced to death as has been the case in times past for those who dared speak truth to power and as still occurs today from time to time in too many countries..
Readers of the Expose and indeed anyone who sees through status, understands that the true powers in this world are hidden. If you ask a group of well informed, well educated, people: Who is running this planet? They will all have different views. But one thing they will all agree on is that whoever that group is, it does not want to be discovered. So we are given the illusion of people power and have representative politicians who are the face of authority. But it is becoming more and more apparent that these faces do not act in our interest and act instead in their own interest and in the interests of their paymasters,
whoever those paymasters might be. The Expose has been at the forefront of exposing their many deceptions.
So what are the main policies of this global government we seek to discover, expose and illuminate?
1. Vaccinate everybody with multiple repeat doses of the same gene altering 2019 spike protein which causes immunological, neurological and cardiovascular damage which far outweighs any benefit after a few weeks
2. Fan the flames of war.
3. Protect and promote Alphabet sexuality especially to minors
4. Stop policing crime and start policing anti globalist political dissent.
Encourage and exonerate lawlessness with corrupt Attorneys General
5. Pretend to support minorities with diversity and inclusivity regulations as a justification for attacking and subjugating majorities - which is the real objective.
6. Break down national borders and national identity. family identity,
community identity, individual identity, gender identity and replace it with social credit score identity
7. Enslave mankind with social credit score linked and vaccination status linked digital smart currencies and passports
8. Control people through engineered deprivation, through manufactured shortages of food, fuel, transport, electricity, gas, water etc.
9. Destroy small and medium sized businesses (hospitality, property, farming etc.) with draconian lockdowns and mountains of bureaucratic regulation.
10. Rewrite history to recast all our ancestors as imperialist slave owners in order to establish a new global empire which enslaves all mankind.
It is a charming manifesto. No wonder these people want to remain hidden.
Most of the policies outlined above are just classic control freak behaviour. The ultimate control freak wishes no man to have any type of personal identity other than the brand mark of being a personal slave (the mark of the beast). But the genetic vaccination, warmongering, alphabet sexuality and lawlessness policies can only really be understood by taking the red pill of Matrix 1 and going on Mission Impossible 9 to breach the impregnable citadel of the hidden city of demonic globalist power.
The first step in this journey is to debunk credibility and to see anticredibility as a more accurate measure of truth. Because credibility is largely controlled by the mainstream media, which is largely controlled by the intelligence services (hence Jack Dorsey of Twitter joked that Mark Zuckerberg should call his new Meta Company the Central Intelligence Corporation). Credibility is given to those who push the false narrative of the globalist castle. Whereas anticredibility (ridicule, ghosting, cancelling, censorship and even criminalisation) is given to those who argue against that demonstrably false narrative.
But we are in a Mission Impossible 9 combined with Matrix 1 movie so we can suspend our disbelief and accept for the purposes of enjoying the story, that certain negative credibility statements are true. Here they are.
1. Adam and Eve were real people (they do not stand symbolically for all men and all women)
2. Cain was the son of Satan (in human form) and pre fall Eve Abel was the son of post fall Adam and post fall Eve.
3. Cain killed Abel after inviting him into a field - the original battlefield in fact.
4. Adam was a human angelic hybrid as was Eve. He was not the first man. He was the first next generation man (Homo Sapiens Sapiens rather than his predecessors, Homo Sapiens, Homo Habilis, Homo Erectus etc. etc.)
5. Adam was a direct first generation angelic and human son of God just like Satan. They were direct brothers. Adam was actually Satan's first direct brother. For Satan was the firstborn angel and he had no direct angelic brothers until Adam. All of angelic creation was through Satan until Eden. Hence the jealousy. It is just that Adam had not yet been conscious in his angelic body whereas Satan had been for thousands of years. The subconscious connects humans to their angelic coprocessors, their cloud servers. Jesus (who was possessed by the angel Michael when the dove landed upon Immanuel, the human son of Mary and Joseph and God), was a later born angel. Actually a 42nd generation angel from the paternal genealogy of Mathew1 with God as Abraham. He became the firstborn angel of all creation, by purchasing those rights from Satan in return for a 6,000 year lease as Caesar to mankind (the greater bowl of soup deal between Jacob and Esau). Jesus was able to grant Satan a 6,000 year lease as Caesar to mankind because he purchased Adam from death for 6,000 years by agreeing to ransom him after he sinned in Eden so as to incur death. `
6. All men and all women, every reader of this article, will within the next 50,000 years (a Pentecost taking a day for 1,000 years) ascend into the heavens as an angel and then ascend further above the heavens as a God. For like begets like and we are all sons and daughters of God. And God will fail with none of us and love will fail in none of us and God is love.
7. All men today on this planet outside of a non adamic church are genetically either Adamic or Cainian. These are the two biblical seeds of fallen man (sentenced to death through ageing). Adam fell in Eden. Cain fell on the battlefield in which he killed his brother Abel.
8. There is a secondary reason for WW3 and a reason for the theory that globalists want to depopulate the planet to save it ecologically all for themselves. This is where things gets really Sci-Fi. There is a greater ark of Noah referred to in Peter's letters. It does not exist in spacetime as we know it because Satan showed Jesus all the kingdoms of the world in an instant of time having taken him up an unusually high mountain. That is symbolism for taking him to a very large spy satellite in which Satan's administration was based. For mountains oversee lands. The key phrase here is: In an instant of time. The literal Greek of Luke 4:5 says: In [a] PUNCTURE of time.
One cannot see more than 200 Kingdoms in an instant of time as a human. But one can see them in a 24 hour day giving them 7 minutes each. Now in Joshua 10, time stood still for a day. This depicts what earth time does for people in the ark. Earth time stands still whilst one is in the ark for a day. Then, for 50 days, the width of the ark in cubits, one can return to the earth arriving back at the precisely time that one left from an earthly standpoint, but having spent 24 hours of ark time in the ark. That is how Jesus saw all the Kingdoms of the earth in an instant of time.
If you think that special relativity is a bit rich for the Holy Bible written between 3500 and 1900 years ago then you have not grasped the science behind Jesus' statement: Who of you by worrying can add one cubit (a measure of length) to your lifespan (a measure of time). Time and space were thought to be independent before Lorentz and Einstein. Jesus equated them in Matthew 6:27 and Luke 12:25.
The Hebrew calendar months of Adar and VeAdar (once every 2 or 3 years) depict this live one day get another day free scenario. For VeAdar is not the 13th month of the Hebrew year. It is a rerun of the 12th month. So you live each day in Adar once and then you live it again in VeAdar. Because you only live twice Mr Bond. This weird (to us) aspect of any true lunar calendar is symbolising the relativistic conundrum of ark time.
This ark can house ALL of mankind. It is a planet sized spaceship outside of normal space time. It has to be outside space time or the demons would inspire the Russians or the Americans to nuke it.
If you think that such a plan is too Sci-fi or too fanciful for God or for the bible then please permit me to introduce you to Mr Elon Musk. He is attempting, within the technological confines of this generation, to do precisely the same thing with a space ship shuttle and the planet Mars. God bless him. He has the same desire to save mankind as God has. That makes him into a true son of God by his actions. Not by wearing a fish shaped hat. And he has put all of his not inconsiderable talent and resources into achieving that goal. Whereas actually God has built a stealthy, planet sized spaceship, which is outside spacetime. I am sure that he will be very happy to have Elon as a passenger in it. It is hard to see how anyone could be more deserving for with the measure which you measure it out, it will be measured back to you.
Since we are in suspended disbelief mode for the basic plot of Mission Impossible9 combined with Matrix1 now with Elon Musk as a special guest star - Here is how the ark that will save us was really built.
All of our ancestors who were chosen to be saints by God and born again angelically (by which is meant that you take ownership of your angelic backup body, rather than borrowing it, and by which is meant you are given the right to have conscious access to it whilst awake rather than subconscious access whilst asleep) could not actually become angelic before Jesus ransomed Adam angelically on 33Nisan16 AD. So after they died as humans, they were resurrected as humans. But obviously not to this planet.
They were resurrected to a different planet. And they have lived there since 2605 BC when Jared (who became Melchizedek in the post flood system) died. Melchizedek, the 2nd Adam, who is the King of Salem, the first Jerusalem, founded the human colony on that planet (which we call Eden2). It is they who are doing the school run in their planet sized 4x4 to pick up their grand children. They built the ark. They are massively more technologically advanced than us because they do not try to kill and corrupt and dominate each other. They try instead to heal and straighten out and empower each other. The purpose of their health service is health not politics and service not profit for big pharma. The aim of every citizen on Eden2 and more particularly of every administrator, is to enable, to empower proactively and actually to ensure, that every person on the planet realises their dreams. So long as those dreams do not have the potential to become nightmares
All the saints will be raptured into the ark before WW3 begins. All those with faith in God (not just in Jesus) will be raptured into the ark before the nuclear part of WW3 (the ride of the 4th horseman of the apocalypse, the one with the long sword of WMDs) begins. All those without faith but with love for their fellowman (the sheep of Matthew25) will be protected throughout WW3 because the Kingdom of God is fully installed under Jesus Christ BEFORE WW3 begins. So the war itself will kill nobody whom God was not going to kill anyway with his lava flood. It is all theatre from the Demons to disguise and upstage the rapture. That is the secondary purpose of WW3.
Yes, on the last day of Adam 90% of mankind will have gone. But they will not all be dead. 50% of us will have been raptured before nuclear war begins and a further 25% will be actually executed and then resurrected out of the world due to love. At most 25% of us will be dead. And that figure excludes the last chance saloon for the really really slow learners in the last week of unauthorised but permitted Satanic rulership of mankind.
I am not going to prove any of this here because this is not supposed to be a religious piece. It is supposed to be a political exposition, a documentary movie without the video.. But I will say this...
We all have the judgement of a God. That is how we are made in God's image. We do not look like God. We judge like God. OK we all make mistakes - loads of them. But the process we go through when we make a flawed imperfect human judgement is the same process that God goes through when he makes a flawless perfect divine judgement. And that is what we are training towards.
That is why governments make every effort they can to deny you the opportunity properly to exercise your judgement (via informed vaccine consent for example). Your judgement, your unique individual judgement that only you yourself can and will make, IS your divinity. It does not matter (spiritually) if you are wrong in the conclusion you reach. What matters is that you made the judgement to the best of your ability given the best of your knowledge and experience in the unique way that you make judgements.
Look at modern man. So busy is he, endeavouring to become a biological electronic hybrid in order to gain a faster intelligence and a longer life. Why does he not know that he is already a biological angelic hybrid with an angelic brain that's 2^30 (1 billion) times faster than his human brain (30 steps up or down Jacob's ladder doubling in speed every step) and that angels do not age biologically. They have indefinite life. We are all so busy trying to achieve what God has already achieved.
Every night when you dream, the dream is shot, the movie is produced and edited, in your angelic brain. It is screened in your human brain. The two are connected by your subconscious. Your angelic brain is Dreamworks. Your human brain is IMAX. That is why, if you go to bed with a problem you often wake up with the solution. The human brain is nowhere near fast enough to shoot a movie in real time. It is just fast about enough to screen one. Only an angelic brain can shoot produce and edit a movie in real time.
The reason that the reader will find many (or all) of items 1-8 hard to believe, or absurd or silly or deluded or naive or fanciful or lacking in credibility or abounding with anticredibility, is that a lot of work has gone into making them such, by the owners of the castle. Here we stand as a race using the CRISPR-Cas9 toolkit of God to soup up viruses which then kill us, whilst refusing to accept that this toolkit, which we did NOT make, but happened across, had a toolmaker, who used it in precisely the same way we are using it, to make the very viruses we are souping up. DOH! We all know full well that every computer virus is a man made hack of a man made operating system. How can we not also know that every human virus is a demonically made hack of an angelically made immune system? How many computer viruses evolved by random mutation of software code? What toolkit did dumb and random chance ever use?
A genetics professor at Queen Mary University once said that we know every word in the genetic code of man but we do not understand the grammar and so cannot construct a sentence from them. And Prof Angel Lopez-Garcia of the University of Valencia wrote a book on the subject called: The Grammar of Genes: How the Genetic Code Resembles the Linguistic Code (2005 Peter Lang). A grammar is used by an intelligence to make a sentence out of words. So both professors are saying that we were made by an intelligence greater than ours (or at least better at genetic grammar than ours).
So now that we have used our limitless imaginations to bound over the walls of the citadel, in the same way that we understand by our spiritual nature the symbolism of the Matrix movies and the non existent imaginary technology of Star Trek, Star Wars and the entire Sci-fi movie genre, we are at last in a position to ask the right question, which is: What is the common factor between all the policies of the global government other than naked control freakery? What is the common goal that all of these policies are aiming for? What is the grand unifying theory of end times politics?
Unbeknown to mankind there have been since Cain and Abel, two types of seed. Two genetic lines of mankind. These are the descendants of Adam such as Abel, as described in Genesis5 and the descendants of Satan through Cain as described in Genesis4. They are different and competing genealogies. All mankind is genetically Adamic or genetically Cainian, unless they have become non adamic already and begun the process of being restored to what Adam lost when he sinned - non ageing human life. These are presently non adamic Abrahamic and non adamic Isaaic. The former will become Melchizedaic when they stop ageing altogether and reverse age back to the genetic perfection which every cosmetic company seeks to sell us. The latter will become Methuselaiain when they do likewise. For those two non adamic patriarchs died for us as well as Jesus did. Because there were 3 crucified at Golgotha in the most important scene in human history, not one and John 19 does not describe them as criminals (although they were literally). In fact they are the unsung heroes of our genetic restoration. They are the answer to every human's dreams For there is no life without sacrifice. And there is no indefinite ageless life without indefinite ageless sacrifice. Incidentally Cainian (male) seed was reintroduced after the flood through the Anakim of Numbers13 (not Anakin of Star Wars).
And unbeknown further even to the deepest of churches, are the 3 salvation covenants for mankind. The covenant of Jacob to be a saint (an administrator), the covenant of Isaac to be a priest and the covenant of Abraham to be a citizen of the Kingdom of God.
And unbeknown to the writer until a month ago are the 3 mirror image demonic condemnation covenants for mankind. The covenant to be possessed by a demon (to be a serpent), the covenant to be a demonic priest, a corruptor of mankind (a viper) and the covenant of Cain to be his seed by actions rather than by genetics, the covenant for those who are corrupted by defiling their consciences and not repenting. They shall go to Hell (a temporary sin bin with a minimum sentence of 33½ years, the length of the life of Jesus before he ransomed Adam, who himself sinned aged 33½, and a maximum sentence of 1,000 years, the length of the Kingdom of God) unless they wake up and smell the coffee.
So that is the battle we all face. Do we obey our consciences? Do we hold on to faith or hold on to love of our fellowman and become sons of Abraham by covenant OR do we defile our consciences, abandon faith, eschew love, pursue power, hatred, corruption and become sons of Cain by covenant, the covenant seed of Cain, the seed of the serpent, the original corruptor of mankind?
1. The therapeutic power of the vaccines is greatest in the first shot. All further doses make things progressively worse therapeutically. But they make the genetic alteration more permanent. Yes, the vaccines are a genetic hack that turns your genes from Adamic to Cainian. For Cain means spike/spear in Hebrew. And the vaccines reprogram your vaccinated cells to make spikes. And the serpent of Genesis 3:15 is prophesied to bite the opposing seed in the heel in the battle of the seeds. A serpent bite is a double injection of snake venom from two fangs. Two vaccine shots, double vaccination. The battle of the seeds of Genesis 3:15 is not merely a battle between the two seeds. It is the battle FOR the two seeds. It is the battle to determine which of the two seeds each one of us becomes. If you permit your genes to become Cainian, you will not be saved unless your actions make you Abrahamic. This is true for the sons of Adam too. But being Cainian gives the demons behind the globalist government more power over your body and over your life.
2. The scripture in Genesis 4:8 which describes Cain assaulting Abel and killing him, clearly implies that Cain invited him into 'the field' where the battle took place. But it does not explicitly say how the invitation was worded. This is because invading armies do not generally invite the countries they are going to invade to join them in their own land which is about to be invaded. They just invade and start killing people on the battle field, following after Cain, the father of such activity. 'The field' referred to in Genesis 8:4, is the archetypical battle field between two brothers. Whether these brothers are Europe verses Europe, The US verses the US, Japan and China, Iraq and Iran, Afghanistan and the Bush Blair Coalition, Russia and Ukraine. It is all the same activity. The aggressor is Cainian and what is worse, wars tend to breed war crimes so that unjustified killing of prisoners and civilians occurs by both sides. They become a murder fest. And a murder fest is a very fast way to create Cainian seed and kill Adamic seed
So now we can see the real reason why Russia invaded Ukraine and why the West will only give Ukraine enough arms to continue the war but not give them enough arms to win the war and why the nations of the world will only enforce enough sanctions to hurt Russia, but not enough sanctions to stop Russia and end the battle that will turn into WW3. Khordokovsky makes it quite plain that the only way to stop Putin is to stop the war in Ukraine preferably by 100% sanctions. Not the 70% we presently have.
The owners of the castle want more seed. They want everyone in the entire world to start killing his brother. It is the fastest way for them to deny salvation and win the battle for seed. Russia will conscript its entire fighting age population. That is the goal. It is not to deNazify Ukraine. It is to Cainify both Russia and Ukraine. It is to get every Russian possible to start killing his brother and to spread that cancer into as many other countries as is possible. So that we all spend a large amount of our time thinking about how to kill our brother. The Russian Ukraine war will become a world war. That is its purpose. The globalists are managing it right now to absolutely ensure that their goal of worldwide murder is reached. The more people they can get to shoot at each other (without justification), the more seed they can make. One of course has the right to self defence and to national self defence. Neither of these activities causes one to become Cainian. But Cain invited Abel into the field. So starting wars is Cainian and war crimes are of course Cainian.
So there it is. The purpose of the war is to recruit people into a covenant that nobody knows exists, mediated by a guy who most people do not believe ever existed, and who nobody believes is actually alive today and is possessing somebody who is directing Cainian operations in some capacity in the present war during which the Russian bear presently has 3 Ukrainian ribs (provinces - Crimea, Donetsk and Lugansk) in its mouth (spouting its narrative whilst being devoured) between its teeth (dividing the Russian military 50% of whom are against the war, the invitation to the battlefield from the bear) in further fulfilment of Daniel 7:5.
3. The way to guarantee that you are saved and therefore actually non adamic Abrahamic or non adamic Isaaic seed (citizens and priests respectively of the Kingdom of God) is to join a true church and stay joined to it unless the church falls. The law of that true church permits anyone to join whatever their past. But one cannot have homosexual sex as a member of a true church (by which is meant two people each of whom have Y chromosomes having sex with one another). So a homosexual would have to abstain for the period after joining the church until he is raptured. This will not be a long period of time. So it is not such a big burden. But it is big enough to prevent many alphabet people being saved by that route. Furthermore any outfit that needs to have a parade to declare how proud it is of itself, is quite obviously still suffering from some kind of shame. It is easy to underestimate the importance of the Alphabet movement to the globalist's demonic plan. Here is why.
The acceptance and the practice of alphabet sexuality, particularly of their sexual grooming of minors and genital mutilation thereof is the legal basis for both WW3 and the coming lava flood according to Leviticus18 and Genesis19. Simply put. God stands up for those who cannot stand up for themselves. If a society tolerates or worse protects by legislation the mutilation of the genitals and the genetic corruption of the immune systems of its children, that society is taking a direct stand against God.
Here is what Leviticus 18 prescribes in that situation: Paraphrasing: If a society indulges in incest, child sacrifice, homosexuality, adultery or bestiality, the land will vomit it out.
Here is what Genesis19 describes: The majority of the men in Sodom were homosexual rapists and God destroyed their city with a lava flood.
Historically Israel was vomited out of its land by being conquered by the Assyrians and the Babylonians and taken into exile in those countries for periods. But the precise wording of any scripture has to be fulfilled. And land is said to vomit out sexually depraved peoples. Land vomits through volcanoes. The vomit of the planet, planetary vomit, is lava. Basically God is casting the planet as a sexual policeman. It literally gags if we behave in a sexually depraved manner. Because we make it sick. Yes. We make our planet physically sick. It is not that God is against sexual fulfilment. He invented sexual fulfilment. But the demons use every powerful force for their agenda. And they seek to corrupt sexual desire to make it unsustainably damaging to society and where better to start than by corrupting our children?
This subject is so important that I cannot just leave it there. There will be no sexual frustration in the Kingdom of God, the next administration of humans on this earth after WW3. NONE AT ALL (I am not saying that I know how to achieve that. But I do know that God is satisfying the desire of every living thing in his kingdom). God wants us all to be sexually fulfilled. But not at the expense of failing to provide a male and a female genetic parent for children wherever possible until they are grown up. For ideally every child should have a loving template from both a male and a female parent to give them emotional security and to provide a yardstick with which to measure friendships and lovers.
Gender is a truly wonderful thing. The biggest test there is for a woman is to hold down a permanent relationship with a man whom she loves. The biggest test for a man is to hold down a permanent relationship with a woman whom he loves. We are all here to learn how to love. Heterosexuality is a mandatory subject in that degree course. Women are the biggest wind up men can ever face and men are the biggest wind up women can ever face and that is deliberate on the part of God. He designed men to wind up women and women to wind up men. We are a totally explosive mixture. And life is about learning how not to explode emotionally at each other. Indeed that is why God designed us to explode sexually in each other instead. It is our release from the emotional wind up of our complimentary genetic natures.
So in God's justice two things inevitably follow sexual depravity. The first is being conquered by an external power (WW3). The second is being wiped out by a lava flood (earth vomit). It is not a coincidence that Putin and the present Russian administration frame themselves as enemies of degenerate Western governments. In that regard they are right.
Dimitry Medvedev, the former Russian president and present deputy chairman of the Russian Security Council (which is doing a great job for Russian security) said on 2022June3
“One can have different attitudes to it, one can believe that the horsemen of the Apocalypse are already on their way and all hope is in Almighty God. However, one can still try to tone down this international situation”
I would absolutely have to agree with every word of that. But with politicians, their words are a mirror image of their actions. The way to tone down the international situation is for Russia to cancel its Cainian invitation to Ukraine to go onto the battlefield.
The 2nd horseman of the apocalypse is War (WW3). The 4th horseman is death who is Satan2 actually, who is Cain. Satan1, his father, has actually repented as prophesied by Jesus. For Jesus said to Satan in Matthew 4:10 bring yourself under Satan, for it is written it is the Lord your God you must worship, having said to Peter in Mark 8:33: Get thee behind me Satan. And that is an interpretation which will get you thrown out of pretty much every church there is. But when you are behind Jesus, you are his follower. And if Satan himself has repented then what are you waiting for? Do you think you have more sin holding you back than he had? However there is no shortage of demons eager to take up his mantle. And Satan2 is his firstborn human son - Cain.
So here is a way to prevent WW3 and to prevent the coming lava flood. Protect children from alphabet grooming and from child genital mutilation. This will not happen at a government level because the demonic globalists control governments not the people. The people themselves are absolutely against alphabet grooming and child genital mutilation. But the people are kept in the dark by the demonic globalists. Hence the Expose and hence this article.
However this turns out at government level, we should do all we can to protect the children and actually women and gender itself and heterosexuality from assault by alphabet sexual imperialism. It is more than ironic that the rainbow was a symbol that God used for his covenant not to bring all flesh to ruin by a deluge of waters in Genesis9. But the rainbow people are a major cause of the deluge of lava, which brings not all flesh but all faithless and unloving flesh to ruin, when the earth vomits at the spectre of our sexual depravity. Their flag is actually prophesying their demise in the greater meaning of Genesis9.
4. The Soros backed Attorneys General and government policies in the US and the UK to stop policing crime and instead police anti globalist political views causes an increase in lawlessness in large cities, which causes an increase in conscience defiling, which causes an increase in Cainain seed. Satanic priests are corruptors, pictured as vipers and as serpents by Jesus and by Genesis. The Gates backed big Pharma take over of healthcare worldwide has the same effect on the consciences of healthcare workers who are forced by profit driven protocols to choose between their salaries and the good health of their patients. If they choose the wrong way, they defile their conscience and it is one more goat to the slaughter. It is especially difficult for doctors who have to train for 7 years and have little chance of equivalent employment elsewhere because they are so specialised. God bless the 100,000 or so UK healthcare workers and the large percentage of US healthcare workers who refused the vaccines on the basis of their medical training. I would just say this. Fight however you can for the truth. God will care and provide for you if you care for his people.
I hope you enjoyed this exposition. It really is a great pleasure to attempt to reveal what the demons have hidden for so long. Every single step in the journey requires a suspending of disbelief. Hence the only way to tell the story was as if it were a movie. You will find the scriptural proof such as we have on www.truebiblecode.com/intro48.html which is ranked about as low as google can possibly rank any website, being vehemently anti vaccine. But we are ranked number 2 on Duckduckgo if you search for 'bible code'. Someone needs to apply for an injunction forcing google to produce a vanilla search free of political medical scientific commercial religious philosophical or other bias.
People say that the difference between a conspiracy theory and scientifically accepted fact is around 6 months. I calculate that the difference between anticredible biblical interpretation and modern day fulfilment is not dissimilar being about the time it will take Monkeypox to infect 1 million people and thereby become a biblical plague. For Monkeypox must be the 6th plague of Egypt - Boils. This fascinating plague did not affect God's people. It only affected Egyptians. So if an active member of your church gets monkey pox then you may not be in a true church (depending upon how or if your church throws people out who lose interest).
A full blown biblical plague of Egypt cannot occur until the modern day Moses has the right to lead God's people off the planet. That cannot occur until the final 42 month lease of the Dragon of Revelation13 ends. So when Monkeypox becomes a biblical plague, or when any of the 10 plagues are seen to be fulfilled, the world has ended judicially, and Jesus has been given authority to take his people out and into the ark, which means the Dragon's authority (Satan's administration) has ended. His response to his loss of authority is WW3. For the plagues were given to Pharaoh after he refused to let God's people go. And Moses would not have asked at God's request, if Pharaoh still had divine authority to rule over them
So here is the Grand unifying theory of 21st Century Politics: The globalist demons have more control over Cainian seed than they have over Adamic seed. So they do everything possible to turn people to the dark side. So that their unconscionable actions or their vaccine corrupted genes make them Cainian. Their chief weapons are control of credibility, vaccination, war, alphabet sexuality, lawlessness, exclusion, deprivation. Everything that they do is to make themselves more Cainian seed to enslave and control.
The reason they have been ramping up their seed production activities during the last 2 years is that the end of their final 42 month lease of Revelation13 over mankind, over both Adam and Cain (by which I mean Adamic and Cainian seed), occurs this year (when the 10 plagues of Egypt begin/become biblical in proportion). At that time, the only power they will have left over mankind is patriarchal power over their seed, their children, Cain. They will have absolutely no power over Adam. So by making you into their seed, they give themselves the authority to continue to trap you in this mad world and prevent you from becoming a citizen of the next, which is the Kingdom of God. This has not been so important to them in times past when they had years of divinely granted secular authority as Caesar over mankind ahead of them. Whereas they now only have a few months (3 we presently calculate). That is why they want to appropriate all of us, even 6 month old babies. Who would be a foetus these days? Either you get aborted or if you make it to delivery then you get gene edited.
.
The strongest protective desire, the most powerful gut reaction that humans and most mammals have as a species, is to protect our young. Politics is about harnessing gut reactions to get votes.
Winston Churchill said: Never let a good crisis go to waste. What I am proposing here is that the modern politician has taken this a few steps further and asked the questions:
What type of crisis do we need?
How could we create such a crisis?
Who could we get to cause this crisis with impunity and how can we be sure to harness the emotional power it creates?
In the last century politicians were largely crisis exploiters. But in this century politicians have become crisis devisors and the mainstream media have always been crisis amplifiers.
The modern politician uses the security services or the police to manufacture a crisis which they then exploit politically (as was the case with the January6 Vote Fraud Protest, known in the mainstream media as the January6 Insurrection, because politicians do not like having their frauds exposed). Politicians no longer have the patience to wait for the right crisis to come along. For mankind ran out of patience as a species a while back - perhaps with the invention of the TV remote control?
In order successfully to achieve this, politicians need to have total control of the mainstream media and of the relevant parts of the security services or the relevant police department and the DOJ and the FBI. They have to be in a position to shut down any effective journalistic or criminal investigation into who really caused the crisis. The plan will fail and be exposed if they have insufficient control of investigative agencies with prosecutorial power. They can get away with alternative media exposure by drowning it out or ignoring it in their mainstream mouthpieces or by censoring it.
A Gallup poll conducted on June23 shows that: 66% of Americans support stricter gun laws, up 14 points since October 2021. That unquestionably is the political dividend that the Uvalde school massacre has yielded. 52% in October was an insignificant majority. But that has now become 66% in June, a very significant majority.
On May 24, Salvador Ramos shot and killed 19 children and 2 teachers in the Robb elementary school in Uvalde, Texas. The 18 year old gunman wore body armour and also shot his grandmother who survived.
Steven McCraw, the director of the Texas Department of Public Safety revealed at a Texas Senate hearing on June23 that one of the teachers, Eva Mireles, rang her husband Ruben Luiz, who was a policeman attending the crime scene and told him she had been shot and was dying. McCraw said that:
"He tried to move forward into the hallway," But "He was detained and they took his gun away from him and escorted him off the scene." -
McCraw did not reveal which agency's officials removed him from the scene.
The order of events was
11:28 Ramos arrives at school
11:29 Teacher calls 911
11:32 Ramos fires multiple shots outside school
11:33 Ramos enters school.
11:35: 3 armed officers enter the school through the same door as Ramos who shoots at them and grazes one of them. They retreat.
11:35: District Police Chief Pete Arredondo arrives without his police radio
11:36: 4 more officers arrive
11:37 Ramos fires 16 shots.
11:40 Police Chief calls Uvalde Police department using his cell phone.
11:40 More shots from Ramos
11:44: Police again enter the building and the Police Chief gets to the door of the classroom in which the children and teachers are being shot and says the door was locked. McCraw, testified at the Texas Senate hearing on June23, that the door could not be locked from the inside. In fact it was not locked. The school video did not show the Police Chief reaching the door at all. The Police Chief calls for a SWAT team and snipers and keys to all school doors and extrication tools on his cell phone.
11:48: Eva Mireles is shot and calls her husband who arrives in the building at this time.
11:52: Further armed officers arrive with a ballistic shield.
11:54 21 minutes after the shooter enters the school, an onlooker, Angel Ledezma, streams a live video showing parents begging police to enter the school.
12:01 DPS Special agent says: This is a hostage rescue situation we should go in.
12:30 Kid calls 911
12:04: By now 19 police officers with 3 ballistic shields are in the hallway outside the classroom.
12:10 SWAT guys arrive and kid makes 911 call from classroom.
12:10 Kid calls 911
12:11 Police Chief Arredondo call for a master key.
12:14 Kid calls 911 again. Contents of call are not released.
12:15 Border Control tactical unit arrives with more shields.
12:16 Kid calls 911 again.
12:17: Arredondo tries master key on different door
12:17: Onlookers beg for action
12:19 Another Kid calls 911
12:21 Another kid calls 911 and 3 shots can be heard during his call
12:26 Arredondo tries to talk to Ramos.
12:35 Officer with forcible entry tool arrives.
12:38 Arredondo again tries to talk to Ramos
12:43 Ramos shoots the door
12:46 Arredondo gets approval to enter (which must therefore have been denied prior to this point - but by whom?)
12:47 Kid calls 911 and says he can hear the police next door- please send them now.
12:50. ONE border patrol tactical officer (not under the police chief) enters the room with the janitor's keys (that were not needed) and kills Ramos.
"Three minutes after the suspect entered the west building, there was a sufficient number of armed officers wearing body armour to isolate, distract, and neutralize the subject," McCraw said. "The only thing stopping a hallway of dedicated officers from entering Room 111, and 112, was the on-scene commander, who decided to place the lives of officers before the lives of children."
"The officers had weapons, while the children had none. The officers had body armour, the children had none. The officers had training, the subject had none," McCraw said Tuesday. "One hour, 14 minutes and eight seconds. That’s how long the children waited, and the teachers waited, in Room 111 to be rescued. And while they waited, the on-scene commander waited for radio and rifles. And he waited for shields, and he waited for SWAT. Lastly, he waited for a key that was never needed."
So here are the facts.
1. The police chief, the onsite commander, dishonestly represented that the door was locked when it was not locked and video shows that he never even reached that door.
2. The police chief commanded his officers not to stop the shooting for 1 hour 14 minutes and 8 seconds on the false ground that they needed the right key for the door or a means of forced entry
3. The police chief had Ruben Ruiz arrested and disarmed and removed from the scene as he was going in to rescue his wife who had been shot and was dying
4. McCraw will not reveal which agency ordered the removal of Ruben Ruiz or which agency was commanding the Police chief Arredondo.
As McCraw stated, there were easily enough armed officers to save every child. The police response time was good. The numbers were good. But the leadership was entirely heartless, entirely satanic. Anyone who denies a husband a chance to save his dying wife is unfit to hold any authority at all. Ruben Luiz was a fully trained police officer. In the end Ramos was taken down by one officer not ten. Ruben could have done that himself. The shooter, Ramos, only shot women and children. He failed to shoot any armed man other than grazing one of them possibly via a ricochet.
But that IS modern policing. The purpose of the FBI or the UK police for that matter is no longer to solve crime or to prevent it. They do not police crime. They police political dissent. Their purpose is no longer to protect the public. It is to protect the false political narrative. The Uvalde shooting is just one more example of that. The agency which instructed Arredondo to apprehend, neutralise disarm and remove Ruben Luiz from the scene was acting to protect the false political narrative that US citizens cannot be trusted with guns, but the state can be so trusted. They did absolutely everything in their power to protect Ramos, the murderer of 19 children, and absolutely nothing to protect those 19 children. That was not an oversight, it was not a mistake. It is their policy and it is a demonic policy.
McCraw drew the conclusion that Arredondo put the lives of his officers before the lives of the children. That is not what happened. He put his orders above the lives of the children. And McCraw will not reveal from whom those orders came. So even today both McCraw and Arredondo put their relationship with their paymasters above the lives of those children. As is the case with every Doctor who has vaccinated a child with a gene corrupting Covid shot.
The inescapable conclusion is that Arredondo and his handlers did not want those children rescued. They wanted them shot. In fact the calls from Arredondo to Ramos were effectively warning to Ramos to finish the job because the Police Chief felt that he could not hold the 19+ officers back any longer. In the end it was an officer not under Arredondo's direct control who tackled Ramos.
But the real villain here is neither McCraw nor Arredondo. It is the agency that ordered Arredondo to apprehend disarm and remove Ruben Ruiz and not to proceed with the rescue of the kids until Ramos had been given the time he needed to kill them all.
This was a political decision made by a politicised agency (because they are all politicised these days). It was more important to that agency to have the crisis to exploit politically than it was to save the children and the teachers. Arredondo was an agent of that agency. And the entire scene played out s if Ramos was too. Welcome to the politics of the 21st century. These and the kind of people we are voting for (or rather Dominion machines and 2000 mules are voting for)..
Being male. I am compelled by my toxic masculinity to provide a fix here. Law enforcement, the public sector, the health services, the intelligence services and some parts of the armed forces are all compromised in the UK and in the US. They none of them provide the services they are paid to provide (as we saw in the withdrawal from Afghanistan, Covid19 policies etc.). Instead they embody evangelise and enforce racist (anti white), sexist (anti male and more recently anti female), genderphobic, heterophobic, familyphobic, paedophilic woke identity politics, the purpose of which is to destroy your personal identity, your national identity your community identity, your sexual identity, your family identity, your professional identity and your artistic identity and to replace them all with a fake manufactured globalist political identity, soon to be codified in your social credit score and your access passport and a social credit score linked digital smart currency which essentially means that the government owns all of your money and determines when or if or upon what you may spend it.
Woke identity politics deliberately fetes minority groups not because it is interested in these minorities themselves. But because it wishes to have a weapon to use against the majority. It falsely represents that it is the champion of the black man, because it is the enemy of all men, most of whom are white in the West. It falsely represents that it is the champion of alphabet people because it is the enemy all people, most of whom are heterosexual.
This is all hyper control freak behaviour. The ultimate control freak invalidates every form of self esteem his victims used to have and replaces them all with a measure of how much his victim is pleasing his controller. What matters to a victim of a control freak is not what he feels about himself. No. It is the esteem in which he is held by his master. Because he has lost all forms of self esteem. Oh I could not possibly do that. It would upset my controller!
The fix is to deny power to the control freaks presently running the woke parts of our establishment. That means firing everybody in the top echelons of the police, the civil service, the entire public sector from local council to quango to industry regulator, the NHS, the intelligence services and the woke parts of the armed forces and banning them from returning for 7 years. The best people to decide how to do this are people who themselves have been fired for not being woke or for being anti woke. All the narrative followers have to be sacked. Anyone who has failed to take a strong stand against woke identity politics must go. If it is hard to determine who is or who isn't woke, then sack the lot of them. They do not do any good anyway. The same needs to be done with MPs or they will corrupt everything all over again. What is needed is a non woke non globalist Tory party offshoot and a non woke non globalist Labour party offshoot etc. Perhaps a National constitution would be the best way to enforce this? Globalists hate national constitutions. Because they wish to be the one government for every single human being on the planet.
The US has hundreds of gun laws most of which are not enforced properly. All they do is reduce the number of guns held by law abiding citizens. They have absolutely no effect of the number of guns held by criminals. If you have decided to commit a high profile mass murder you are not going to be dissuaded by gun laws. You know you are going to jail for the rest of your life for mass murder anyway. But the globalists wish to enslave everybody on the planet. And the 2nd amendment stands in their way. That is what those 19 kids and 2 teachers were murdered by that hidden agency for. The agency that Arredondo obeyed and that McCraw protected. They were sacrificed to move public opinion by 14 points in the battle by the deep state globalists to disarm all opposition to their enslavement The purpose of the 2nd amendment is to provide the people with a means to prevent the government from becoming tyrannical.
Here are the names of the people that the present tyrannical administration, for political advantage, prevented 19 police officers from saving on May 24.
Irma Garcia, 48
Eva Mireles, 44
Miranda Mathis, 11
Layla Salazar, 11
Nevaeh Alyssa Bravo, 10
Makenna Lee Elrod, 10
Jose Manuel Flores Jr., 10
Eliahna Garcia, 10
Uziyah Garcia, 10
Amerie Jo Garza, 10
Xavier Lopez, 10
Jayce Carmelo Luevanos, 10
Tess Mata, 10
Alithia Ramirez, 10.
Annabell Rodriguez, 10
Maite Rodriguez, 10
Alexandria “Lexi” Rubio, 10
Jailah Nicole Silguero, 10
Eliahana Cruz Torres, 10
Rojelio Torres, 10
Jacklyn Cazares, 9
https://expose-news.com/2022/07/30/the-rise-of-the-new-woke-religion/
The most help I can give anyone to understand what is going on with gene hacking vaccines, with the great reset into a social credit score controlled universal digital currency and with the blind wokeification of mainstream media, of governments and of large corporations against the will of the majority of the people whom they are supposed to be informing, representing and serving is to expose who is behind these changes and what the real purpose of their global agenda is.
The trouble I have is that in order to do that I have to bust through thousands of years of psy ops which have been the preparation for the coming global war. But the wonderful thing about language is that there will be a phrase which has that power. All I have to do is find that phrase and thousands of years of deception are undone.
Here are my first shots at it..
1. There is always a king, democracy is merely his camouflage.
2. "Hi. I'm Cain, the new Satan. Me and my pals will be stealing absolutely everything you own, taking control of every single financial transaction you hope to make, robbing you of every freedom you have ever had and then stealing your very genes themselves under the guise of a vaccination (cool trick huh?). We will be turning you into our slaves. Regrettably we are heartless control freaks. So any resistance to our plan will be suicidal for you. We will either kill your ourselves directly or send you to the front lines in WW3 or get you with our latest plague or starve you of well - of absolutely everything really - by excluding you from the financial system with this new wizbang 2 factor identification wheeze we are forcing every financial institution to adopt under the premise of extra security. I am afraid you will fail to be identified. Your own computerised money will say: No. But there again it was never really your money now was it? No it was all mine. In fact everything is mine. And you are mine. Well, either that or you are dead. One other piece of advice. I like to be worshipped (a lot). So join my little ole church of woke would ya - there's a good fellow."
"We tried the above on a focus group and it didn't play too well. So instead our agents pretend that we are precisely the opposite of what we really are. Whereas we pretend that we do not exist at all. So...
Don't stop believing - that I am a fairytale."
3. Whoever the King of the world is. He plainly does not want to be identified. What is the purpose of Identity politics? To manufacture a fake identity which masks and actually replaces your true identity. The greatest manifestation of that device is demon possession.
But just in case none of the above hit the spot, I have prepared a table below which compares biblical Christianity to this 'new' religion of Wokeness. It shows clearly that the two are polar opposites. I did not prepare the table to bore you with an academic comparison between two religious ideologies (well not entirely for that reason). No. I prepared it to prove to you that those behind the church of woke are the spiritual enemies of Jesus and Christianity, the modern day Pharisees, the serpents, the offspring of vipers of Matthew23. Yes, the demons. Their religion is anti Christian and their leader is therefore the anti Christ. I could find no tenet of biblical Christianity that is not reversed in wokeism. If you can find one please put it in the comments below!
Doctrine | Biblical Christianity | Woke Morality |
OFFENCE | 39 But whoever slaps you on your right cheek, turn the other also to him. (Matthew 5) | Shun Cancel Censor Deplatform Sack Exclude Invalidate and Slander those who offend you or your adherence to Woke dogma |
FAMILY | Heterosexual genetic parents should have all authority over their children. To God the state is just another person like your neighbour is. So giving authority over your children to the state is as daft as giving it to your next door neighbour | The State owns your children and knows what is best for them. The family is an obsolete paradigm |
LOVE: | 18 Thou shalt not take vengeance, nor bear any grudge against the children of thy people; but thou shalt love thy neighbour as thyself: I am Jehovah. (Leviticus 19 ASV) 44 Love your enemies and pray for those persecuting you; (Matthew 5) |
Hate your enemies whilst defining them as the haters by falsely classifying any criticism of woke dogma as hate speech. Whereas in truth wokeness is the religion of hate by cancellation shunning exclusion deplatforming imprisonment and censorship. Wokeness is the baseless hatred of natural human behaviour. |
NATIONALISM: | 4 And they said, Come,
let us build a city [administration] and a tower with its head in the heavens [satellite surveillance state], and make a name for ourselves,
lest we be scattered on the face of all the earth. (Genesis 11)
God divided the languages at Babel and created the nation states to prevent a global political monopoly |
What we need is a global political monopoly and global surveillance technology using heavenly spy satellites to enforce it. We no longer need national boundaries at all. |
SEXUALITY | 22 'And you must not lie down with a male the same as you lie down with a woman. It is an abomination. (Leviticus 18) 26 For this cause God gave them up unto vile passions: for their women changed the natural intimacy into that which is against nature: 27 and likewise also the men, leaving the natural intimacy of the woman, burned in their lust one toward another, men with men working unseemliness, and receiving in themselves that recompense of their error which was due. (Romans 1 ASV) Heterosexuality is natural. Homosexuality (male) is a mortal sin. Lesbianism is unnatural .. |
Society has hitherto been Heteronormal defined as follows: Heteronormativity is the belief that heterosexuality is the only natural expression of sexuality in our society. This belief system can be harmful to sexual minorities because it creates a hierarchy among sexual practices that can reinforce heterosexism and homophobia. - www.masterclass.com
Yes. that is the biblical belief. Whereas woke dogma is the precise opposite, and it reinforces heterophobia and homosexism. Heteronormativity is as damaging to sexual minorities as is a warning sign before a hole in the road. It is protective of children against paedophiles and groomers and genital mutilators from sexual minorities. Indeed the potentially terminal danger of alphabet sexuality is that it rates the sexual gratification of adults above the emotional security of children who are denied a parent from each gender. Never has this been more clearly displayed than in the refusal of too many homosexuals to wear condoms during the AIDS crisis (which is still ongoing). These people rated the marginal difference in sexual pleasure resulting from not wearing a condom as of higher value than the lives of the parents of 20 million AIDS orphans worldwide peak in 2004 and 15 million today. Face masks for Covid were mandatory. Condoms for HIV never have been. The emotional insecurity of children today becomes society's insecurity tomorrow. How will those kids respond to a nuclear threat when their generation takes over? |
GENDER: | 22 And Jehovah God proceeded to build the rib (XX) that he had taken from the man into a woman and to bring her to the man. 23 Then the man said: This is at last bone of my bones And flesh of my flesh. This one will be called Woman, Because from man this one was taken. (Genesis 2 NWT) Adam was XXXY with 24 Chromosome pairs before God removed the XX and formed it into Eve. Rib stands for Chromosome, the genetic building block for the skeletal building block.. God himself in whose image Adam was made is XXXY, being fully male and fully female. If all your cells have a Y chromosome you are male, a man. If they do not you are female, a woman. |
Whatever gender you feel like that morning. The BBC has 150 Genders. Male, Female, and 148 subspecies of Jimmy Saville
Wokeism espouses every means possible to corrupt the biological reality of two genders, from creating bogus genders, to genital mutilation, to deliberately taking the wrong sex hormones for the genetics of your body cells - which seriously reduces your life expectancy. A Massive study shows transgender women & men on hormone treatment are 3.8x & 1.5x more likely to die than biological women & men. They have increased cancer, cardiovascular disease, HIV and suicide mortality rates In Norway it is illegal and punishable by up to 3 years in prison to state biological truths such as men cannot give birth. |
FORGIVENESS | 31 On this account I say to you, Every sort of sin and blasphemy will be forgiven men, but the blasphemy against the spirit will not be forgiven. 32 For example, whoever speaks a word against the Son of man, it will be forgiven him; but whoever speaks against the holy spirit, it will not be forgiven him, no, not in this system of things nor in that to come. (Matthew 12). Yes. But it will be forgiven in the system after the Kingdom of God (that to come). Because there is no sin too large to be forgiven by God. Even the sin against the Holy Spirit. Why is Satan still alive?. |
There is no sin against wokeness too small to be punished. Even mispronouning is a national emergency. |
JUSTICE | 23 But if injury occurs, you shall give life for life, 24 eye for eye, tooth for tooth, hand for hand, foot for foot, 25 branding for branding, wound for wound, stripe for stripe. (Exodus 21 GLT) |
Tweet for Job |
BATTLE OF THE SEXES | The Man is head over the woman in the family and in the church. Not in business or in politics. The woman is designed to help the man exercise power more justly. | Masculinity is toxic in all settings. The woman will always therefore make a better head. Women should compete with men for power and rather than supporting them in their careers, they must be given the power to destroy the careers of men who attempt to have relationships with them. See the case of MIT Prof David Sabatini and Kristen Knouse. In a few years time, the only men who will be willing to risk attempting to have a relationship with a woman will be the self employed or the unemployed. But of course having a homosexual relationship - no problem. |
IDENTITY | Personal, Family, Tribal, Ancestral, Community, National, Religious identities are really important. Every Old Testament Jew knew precisely where he came from.. | You have no identity. You do not need a family. You do not need a country. You do not need a faith based religion. You just need to do like you are told be the new religion wokeism. |
THEFT | 15 Thou shalt not steal. (Exodus 20 KJV) | Stealing from shops in big cities in the US is fine under $1,000 per theft. Burglary in the UK has a conviction rate of less than 1%. |
PHARMACEUTICALS | 19 Manifest but is the works of the flesh, which is fornication, uncleanness, loose conduct, 20 idolatry, druggery (pharmakeia), enmities, strife, jealousy, angers, contentions, divisions, sects, 21 envies, drunkennesses, revelries, and the (things) like to these, which (things) I am saying before to you according as I said before that the (ones) the such (things) performing kingdom of God not they will inherit. (Galatians 5 KIT) One can still enter into the Kingdom of God as a citizen without inheriting it as a possession as a saint. |
Doctors must only prescribe the drugs mandated by protocols drawn up by government agencies funded by the drugs companies, or they lose their licences. You must take the drugs you are mandated to take or you can forget about your life. |
CHARITY | 22 you people must not afflict any widow or fatherless boy. 23 If you should afflict him at all, then if he cries out to me at all, I shall unfailingly hear his outcry; 24 and my anger will indeed blaze, and I shall certainly kill you with the sword, and your wives must become widows and your sons fatherless boys. (Exodus 22 NWT). True worship is looking after widows and orphans personally. We must learn to exercise love through charity individually |
Raise the tax burden so high and create such huge price inflation of basic necessities that nobody can afford to look after themselves let alone widows and orphans. Leave charity to the state and their social services. |
VEGETARIANISM | 3 Every moving animal that is alive may serve as food for you. As in the case of green vegetation, I do give it all to you. (Genesis 9 NWT) After the flood God gave mankind neat to eat. And during the Lord's evening meal (the Christianised Passover) lamb should actually be eaten as Jesus did on 33Nisan14 ! |
Save the planet - eat bugs and veggies only. Whereas in truth pastures need herd animals and as Allan Savory has shown and as every gardener knows, widely distributed animal dung revitalises grasslands so that they grow back. Then they can once again store Carbon Dioxide reducing global warming. |
HISTORY | Do not deny it. Do not revise it. Accurately record it (as did the bible) and learn from it. Treasure mankind's history. It is all a lesson from God. It is our eating from the tree of good and bad. | Mankind's history is a catalogue of abuse by people who were not woke enough. All your heroes were villains. Any statue to any human is to be defiled and torn down. You will revere and worship nobody and nothing except wokeness. |
ABORTION | 22 And in case men should struggle with each other and they really hurt a pregnant woman and her children do come out but no fatal accident occurs, he is to have damages imposed upon him without fail according to what the owner of the woman may lay upon him; and he must give it through the justices. 23 But if a fatal accident should occur, then you must give soul for soul (Exodus 21 NWT) Abortion is OK until the foetus becomes a soul, a human being, which is a body with God's spirit in it. God's spirit is our DI (Divine Intelligence) as opposed to our AI. The foetus becomes a soul when God breathes his spirit, downloads his DI into it, after both halves of the brain join up just before mid term, around 19 weeks. Premature babies can survive after 22 weeks these days. Its murder after mid term (19 weeks) |
Women should have the right to kill their children at any time up to birth (NY, CA, VT, RI NM). Even though it is known that after 22 weeks they are viable if born. |
RACISM | 12 A certain one of them, their own prophet, said: Cretans are always liars, evil wild beasts,
unemployed gluttons. 13 This witness is true. For this very cause keep on reproving them with severity, that they may be healthy in the faith (Titus 1) Here is a racial profiling of those in Crete accepted by St. Paul. He recommended severe reproof. He did not theorize that their bad behaviour resulted entirely from historic institutional and individual racial prejudice against people who lived upon that particular island. So we can and should Judge a person by his character and judge an entire race by its character. Because to God a race is one person, Israel, for example was both one person. Jacob, and the entire race. God saves people in all races but he chose Israel to be his first representative. God uses the same criteria for each race for salvation. Do you obey your conscience? Do you have faith in me? Do you love your brother as yourself? |
CRT teaches that the success of any racial group is not down to the efforts or capabilities of that group but is rather down to the level of prejudice of the state and of the consciousness of the people in the state for or against that racial group. It attributes all success or failure to the racial prejudice of others and none to the effort or the capability of an individual or indeed of his race. As if no one or no race could ever achieve anything for themselves. It seeks to enforce equality of outcome for races. It is just racial communism. Whereas the true determinant of success is not race, but is the cohesion of the family and the effort put into the individual by his parents by his educators and by himself. This is why in the US Asians (with the best family cohesion) do the best and Carribeans (with the worst family cohesion) do the worst If you get no love from your family then you lack self esteem and you are more likely to commit crime, do drugs and fail economically. |
SLAVERY | SLAVERY: Abraham owned 318 slaves in Genesis 14:14. The early Christians described themselves as slaves of God. God is not against slavery. He advocated it in the law of Moses
2 If a thief should be found in the act of breaking in and he does get struck and die, there is no bloodguilt for him. Slavery was used as a form of privatised prison with a maximum sentence of 6 years of Deuteronomy 15 and as the original form of privatised social services. If you ran out of food you would offer your labour to your associate and if that was not enough you could sell yourself to him. There was no unemployment benefit back then. God provided that all Hebrew slaves should be released at the start of the 7th year of servitude. BUT God required Hebrews to treat their Hebrew slaves as hired labourers and not put them under slavish forced labour and not tread down upon them with tyranny (Leviticus 25) |
Slavery to men is bad because one cannot trust humans to love their slaves and refrain from abusing them. We can only trust the state in that regard. Slavery to the state is great. We should all aspire to be slaves of the state. We should pay more than 50% in tax. We should accept that the state owns our children just like the slave owners of old owned the children of their slaves. We should permit the state to decide what we can and cannot buy, what we can and cannot do and where we can or cannot go. I mean we don't want the lower orders meandering aimlessy around the globe on package holidays spewing out carbon do we? We can leave that to the climate change activists in their private jets right? |
FINANCIAL FREEDOM | 25 And Judah and Israel continued to dwell in security, everyone under his own vine and under his own fig tree, from Dan to Beer-sheba, all the days of Solomon. (1 Kings 4 NWT)
Solomon's kingdom was the most happy and peaceful and wealthy and prosperous in the history of Israel precisely because everybody in it was individually wealthy and self sufficient and therefore financially independent. They owned everything they needed themselves. they were not reliant upon the state or upon large corporations. They they were happy, wealthy and secure. 21 And they will certainly build houses and have occupancy; and they will certainly plant vineyards and eat [their] fruitage. (Isaiah 65 NWT) |
In woke globalist ideology we will all own absolutely nothing and then supposedly be happy. But that is quite obviously a lie. If we own nothing we will be miserable and unhappy until justice and fairness are restored and the Bishops of wokeness return to the people what they have stolen from every one of us. If we work and receive no fruits of our labour then we are slaves with no release. That is an injustice and injustice always leads to pain suffering and misery. |
The bible teaches to turn other cheek when offended. The woke cult teaches to shun to cancel to exclude and to destroy the career of those who take a position deemed offensive to the cult..
38 You have heard that it was said: "An eye for an eye, and a tooth for a tooth;"
39 but I say to you, Do not stand against the evil [man] but whoever strikes you on the right cheek, turn the other to him also. (Matthew 5)
What does this mean that we should not stand against the evil one? If he rapes our firstborn daughter should we hand him also our secondborn?
Jesus answers that question by giving us the relevant law for comparison which in full says...
19 And when a man causes a blemish in his neighbour, as he has done, so it shall be done to him;
20 break for break, eye for eye, tooth for tooth. As he has given a blemish [to be] in a man, so it shall be done to him. (Leviticus 24 GLT)
23 But if injury occurs, you shall give life for life,
24 eye for eye, tooth for tooth, hand for hand, foot for foot,
25 branding for branding, wound for wound, stripe for stripe. (Exodus 21 GLT)
So lasting damage is to be repaid. But embarrassment, offence, insults or temporary damage are not policed. Further the law of Moses deputises all citizens into law enforcement should they wish by saying...
2 If the thief is found breaking in, and is stricken and dies, no blood [shall be] shed for him.
3 If the sun has risen on him, blood [is] due for him;
repaying he shall repay. If he has nothing, then he should be sold for his theft. (Exodus 22 GLT)
So if someone unrelated to the crime, sees a break in and intervenes during that break in to physically prevent it, and is resisted by the thief to the point where the thief is killed. Then there is no bloodguilt. This is because the thief is breaking the law. So his law breaking can be resisted with impunity.
Does this mean that if you see a child stealing a bar of chocolate from a shop you can kill him with impunity? No. Because the law has a comparison between killing the thief as a way of stopping the theft and killing the thief in a way that is definitely not for that purpose. So for example if you stopped a thief and tied his hands at the scene, and then killed him 5 minutes later but during the day of his theft, you would be blood guilty. Because the principle is that you only escape bloodguilt if you are policing the theft itself. Likewise it is not necessary to kill a child (unless he is armed) in order to stop a theft. So if you killed child stealing a chocolate bar in circumstances where you had the opportunity to stop the theft without killing him (by grabbing his hand and removing the chocolate bar for example). You would be blood guilty. One is only guilt free from the killing if one's actions were policing the theft period. A deliberately heavy handed policing of a theft, where for example a man punched a female thief in the face and knocked her out and she died, in circumstances where she was not offering resistance which required that level of response from the man to successfully prevent the theft, would also be treated as homicide.
This of course is the principle that has historically failed to be applied by American police officers. But has historically more successfully been applied by British police. American police appear to believe that they have the right to kill suspects who do not immediately obey their commands. Now if that command is to drop the weapon, then they have a case, But if that command is stop thief then they have a case only if there is no other means to prevent the theft other than shooting the suspect. If they have a taser for example but they choose to use a gun, then they are blood guilty and that is homicide. If the thief drops the stolen goods and runs off, and is shot after dropping the goods, that would also be homicide and the police would be blood guilty. If the thief ignores the command to stop thief and runs off with the goods and if the police immediately shoot him, that would be homicide and the police would be blood guilty because it has not yet been determined whether the police could have run after the thief and apprehended him.
The idea that a police officer can shoot a thief because he cannot be bothered to give him chase is abhorrent. Killing a thief in the act is only justified when that is the ONLY AVAILABLE method of preventing the theft.
If for example the thief is known to the police and is on social security and is a drug addict stealing to fund his habit (as most of them are). Then shooting him is not the only method to prevent the theft. The better method would be to treat his addiction. And failing that one could dock the value of his theft from his social security payments.
So the bible position is that one can resist lawlessness, but not bad behaviour which does not break the law - such as insults, offence, slaps, embarrassment, put downs etc. Hence the expression: Sticks and stones can break my bones but words can hurt me nothing.
So yes one would resist a wicked one who was attempting to rape one's daughter. But one would be Chris Rock if being slapped in front of millions of people.
If the wicked one was trying to slap one's daughter or an elderly frail person one could resist him if there was a significant danger of some type of lasting damage..
So one is advised not to defend one's own ego or one's wife's ego as was the case with Will Smith. But instead to defend God's law, if desired. For the security of society generally depends on the latter not the former.
But even that does not go far enough. The security of a society is directly proportional to the efficiency of its policing of lawlessness and inversely proportional to how easily offended its members are. The more offence people take in matters which do not break the law (i.e. cause lasting physical damage) the less stable society is. That is assuming that the law is God's law which protects against lasting physical damage but not against emotional damage.
Admittedly emotional damage can be just as devastating as physical damage. Indeed it is the cause of many suicide attempts over relationship rejection etc. But God's law advises people to build up the emotional strength necessary to handle offence without heartbreak whilst actively preventing lasting physical damage such as a broken bone.
It's all a question of what we ourselves should police and what the state should police. The bible advises that human hearts should police human hearts and that the state should only police lasting physical damage. The Woke religion advises the opposite as regards human hearts. The police in the UK do on occasion arrest people who cause lasting physical damage. But in the US they do not if the perpetrator is woke (such as a member of BLM). Because the purpose of the police force to the 46th president (Barack Obama) is to play politics with the law. Just as it is all to often over here in the UK, where we no longer police theft in any meaningful way.
Jesus advises people not to be snowflakes. The woke religion legislates to protect snowflakes.
The bible legislates heavily to protect the cohesion and sanctity of the family and the right of children to have two genetic parents one of each biological gender, who have full responsibility for every aspect of the child's life. The Woke cult takes the opposite position. It actively seeks to destroy the family and hand over all children to the state. Just as the children of slaves were owned by the slave masters. So the children of citizens in a Woke state are owned by the state (as regards education, healthcare, child services, sexual initiation etc.). Indeed slave owners had sexual rights over the children of their slaves. Whereas today the Woke state practices sexual initiation, child grooming, sexual indoctrination and genital mutilation on children in its authority - often without reference to the parents.
Maureen Martin whilst standing for Lewisham Mayor pledged to: Cut through political correctness and state the truth that natural marriage between a man and a woman is the fundamental building block for a successful society, and the safest environment for raising children
She was sacked from the London and Quadrant Housing Trust as a result of her true statement. But homosexuals have historically (in 2015) been 15x more likely to be paedophiles than heterosexuals. Hence children are safer from sexual predators in heterosexual marriages than they are in male male homosexual marriages. This is because paedophilia is disproportionately male and disproportionately homosexual compared to the prevalence of men and homosexuality in society in general. So the London and Quadrant Housing Trust is actually siding with homosexual paedophiles and against children.
Fiona Fletcher-Smith, Chief Executive of L&Q, said: 'While we respect that individuals' freedom to hold particular religious or other beliefs is absolute, we do not tolerate it when these beliefs are manifested in a way that is derogatory or offensive to others.
There is some classic double speak for you. If their respect was absolute, then they would ABSOLUTELY tolerate speech that was subjectively judged by sexual activists to be derogatory or offensive.
Maureen is quoted as saying: The message this is sending is if you want to engage politically and make a difference in your community, but if your views don't line up with the liberal agenda, you can potentially be fired from your job.' She further explained that: I was not going to back down from my Christian values. I will defend them. Whereas the Daily Mail reported that London and Quadrant was fiercely proud of its endorsement by Stonewall.
It is a classic example of Biblical Christianity being the direct opposite to Wokeness.
Abraham owned 318 slaves in Genesis 14:14. The early Christians described themselves as slaves of God. God is not against slavery. He advocated it in the law of Moses at Exouds22 for thieves who were unable to repay what they stole. Slavery was used as a from privatised prison with a maximum sentence of 7 years and as the original form of privatised social services. If you ran out of food you would offer your labour and if that was not enough you could sell yourself to your brother. There was no unemployment benefit back then. God provided that all Hebrew slaves should be released in the 7th year of servitude.
12 [And] if thy brother, an Hebrew man, or an Hebrew woman, be sold unto thee, and serve thee 6 years; then in the 7th year thou shalt let him go free from thee. (Deuteronomy 15 KJV)
Jesus did not advise slaves to rebel against their masters. Slavery was also a privatised from of imprisonment...
2 If the thief is found breaking in, and is stricken and dies, no blood [shall be] shed for him.
3 If the sun has risen on him, blood [is] due for him;
repaying he shall repay. If he has nothing, then he should be sold for his theft. (Exodus 22 GLT)
So thieves who stole and were caught and were unable to repay were sold as slaves for 6 years. TO the person from whom they stole.
12 [And] if thy brother, an Hebrew man, or an Hebrew woman, be sold unto thee, and serve thee 6 years; then in the 7th year thou shalt let him go free from thee. (KJV)
13 And when thou sendest him out free from thee, thou shalt not let him go away empty: (Deuteronomy 15 KJV)
The Law of Moses permitted slave owners to beat their slaves almost to the point of death but not actually to that point. Today that seems to us to be an inhuman law which should never have been enacted. How can such a law have come from a loving God? The answer appears in Leviticus25...
39 'And in case your brother grows poor alongside you and he has to sell himself to you, you must not use him as a worker in slavish service.
40 He should prove to be with you like a hired labourer,
like a settler. He should serve with you till the Jubilee year [or after 6 years of Deuteronomy15, whichever is the sooner].
41 And he must go out from you, he and his sons with him,
and he must return to his family, and he should return to the possession of his forefathers.
42 For they are my slaves whom I brought out of the land of Egypt. They must not sell themselves the way a slave is sold.
43 You must not tread down upon him with tyranny, and you must be in fear of your God.
44 As for your slave man and your slave girl who become yours from the nations that are round about you people, from them you may buy a slave man and a slave girl.
45 And also from the sons of the settlers who are residing as aliens with you, from them you may buy, and from their families that are with you whom they had born to them in your land; and they must become your possession.
46 And you must pass them on as an inheritance to your sons after you to inherit as a possession to time indefinite. You may use them as workers, but upon your brothers the sons of Israel, you must not tread, the one upon the other, with tyranny.
(Leviticus 25 NWT)
The foreign slave you could use as a worker. But he too had some protection from Exodus 22...
21 And you must not maltreat an alien resident or oppress him, for you people became alien residents in the land of Egypt. (Exodus 22).
So both the national and the foreign slaves should be used as hired workers (i.e. precisely as a permanent employee today), not as workers in slavish service and neither group should be maltreated or oppressed. although what redress either type of slave would have in the event of tyrannical or slavish treatment which fell short of causing physical damage (for which they were to be released) I do not know.
So God gave individuals huge authority over their slaves. He did this in order that they should learn how to exercise that authority with compassion rather than the state denying them that lesson. He trusted them to learn it. He did not trust the state to enforce it. It is the power balance between the state and the individual that God views so differently from modern man. The state back then could kill and maime tens of thousands of their subjects with impunity in unjustified wars. Slave owners could kill nobody and if they maimed their slave he had to be set free. Today we condemn slave owners whether they abused their slaves or not. But we continue to fight unjustified wars which are incalculably more horrific without properly condemning those who instigate them. Indeed we shower state honours on Sir Tony Blair. Meanwhile the state is in the process of enslaving us all through the great reset and social credit score linked digital currencies.
Wokeness is the precise antithesis to Christianity. It is the tacit rejection of every principle that Jesus Christ died to defend and to establish. It is therefore the fastest path to moral destruction that it is possible to follow. For the purpose of Biblical morality (when properly understood) is to prevent a society of free willed beings from destroying itself, without unduly limiting their free will. Therefore Woke worship is the very religion of the demons. Therefore they are right now down here recruiting worshippers for their church of damnation. If you are woke, you are in that church. Of course they do not announce that they are here because they can only succeed by deception. They do not even admit that they are running a church. So repulsive is their true agenda and so inhuman are the ways in which they seek to achieve it.
If you are woke you are an enemy of mankind's love, of mankind's joy, of mankind's empowerment, of mankind's advancement, or mankind's survival, of mankind's future, of mankind's past, of mankind's present and of mankind's salvation because your hidden masters are such, and have been such enemies for 6014 years since Adam's sin Eden. You of course will probably not realise that. Because just as Eve was, you are presently being thoroughly deceived by demons who are possessing humans and who are running a church whilst pretending that they are not demons and not running a church. Hence this article.
Any group which censors deplatforms persecutes excludes shuns imprisons fires or kills critics knows that its position is untenable and will not stand up to proper scrutiny and values power more than it values truth or love.
Many religions including Christianity have been guilty of every item in the list above. Hence I refer to Biblical Christianity which regrettably is not too close to the religion as practiced in many Christian churches today.
I am not arguing here for any particular Christian church - so abusive have been their attempts to represent the Christ (although I do happen to run one). But I do argue for the Biblical Principles of Christianity, which is essentially spiritualized post genetic Judaism in my opinion, and is referred to politically with terms such as Judeo Christian values.
The argument is that Wokeism, by its unmistakeably anti Christian doctrine, reveals its true sponsor to be the Anti Christ, the king of the descended demons. And furthermore that its recent global rise to prominence proves that they are right now down here seeking your worship.
Doctrine | Biblical Christianity | Woke Morality |
OFFENCE | Turn the other cheek | Take Offence and do not accept apologies |
FAMILY | Model for all morality | Obsolete Paradigm to be dismantled |
LOVE: | Love thine enemies | Hate cancel and deplatform your enemies |
NATIONALISM: |
Nation states were designed at Babel to prevent a global political monopoly |
What we need is a global political monopoly |
SEXUALITY | Be Heterosexual | Be Alphabet with no H. Destroy Heteronormalcy - move ever closer to Paedophilia. |
GENDER: | Binary: 2 Biological genders | Non Binary. Deny Biology. |
FORGIVENESS | Forgive trespassers who repent | Do not forgive trespassers even when they publicly repent |
JUSTICE | Eye for eye tooth for tooth. Do not be partial in judgment. Hear the little one the same as the great one. | Tweet for Job. Persecute the non woke exonerate the woke. |
MEN & WOMEN | The Man is the head. The woman is designed to help the man exercise power more justly & lovingly | Masculinity is toxic. Women therefore make better heads. |
CROSS DRESSING | A woman shall not wear a man's garment, nor shall a man put on a woman's cloak, for whoever does these things is an abomination to the Lord your God. | Drag Queens for kids. Pride parades for Drag Queens |
CHILDREN AND SEX | Parents determine age of sexualisation & age of consent. No procreative sex outside of a marriage agreement | State forces sexualisation & non binary grooming onto minors. It preaches & facilitates gender mutilation of pre-pubescents under the risibly false pretext that they know what sex their body should be before their body is capable of having sex |
IDENTITY | Personal, Family, Gender, Tribal, Ancestral, Community, National, Religious identities are really important. Every Old Testament Jew knew precisely where he came from.. | You can identify as whatever you like. You do not need a family. You do not need a country. You do not need a faith based religion. You just need to do like you are told by your Woke Meisters (Demon possession is the ultimate identity fraud). |
THEFT | Thou shalt not steal. | Theft is not to be policed because everyone will soon own nothing and be happy. We do not wish to empower people with ownership of anything. |
PHARMACEUTICALS | No kingdom inheritance for those who indulge in Pharmacology (farmakeia) | No job or holiday for those who fail to take government recommended pharmaceuticals |
CHARITY | True worship is looking after widows and orphans personally. | Create 20 million widows and orphans by failing to manage HIV and manufacturing unjust wars. Leave charity to the state. |
VEGETARIANISM | After the flood God gave mankind neat to eat. | Save the planet - eat bugs and veggies only. Whereas in truth pastures regenerate and store more CO2 when fertilised by herd animal dung |
HISTORY | Do not deny it. Do not revise it. Accurately record it (as did the bible) and learn from it. Treasure mankind's history. It is all a lesson from God. It is our eating from the tree of good and bad. | Mankind's history is a catalogue of abuse by people who were not woke enough. All your heroes were villains. Any statue to any human is to be defiled and torn down. You will revere and worship nobody and nothing except wokeness. |
ABORTION | No abortion after the foetus becomes a human soul (around 19 weeks when the central nervous system is completed and the two halves of the brain are connected) | Women should have the right to kill their children at any time up to birth (NY, CA, VT, RI NM). Even though it is known that after 22 weeks they are viable if born. Albert Einstein was 2 months premature = 29½ weeks. Sir Isaac Newton was born weighing 3 lbs = 29 weeks. Sir Winston Churchill was 2 months premature = 29½ weeks |
RACISM | God is not partial. But in every nation the man that fears him and works righteousness is acceptable to him | CRT is just racial communism where all success or failure is falsely ascribed to privilege or prejudice in others rather than effort or indolence, natural talent or aptitude on the part of oneself. It falsely classifies 'whites' as a race and 'blacks' (by which is generally meant Afro-Carribeans) as a race. Blames 'whites' for the excessive criminality of 'blacks' which is not seen in Asians. |
SLAVERY | Abraham owned 318 slaves in Genesis 14:14. The early Christians described themselves as slaves of God. God is not against slavery. He advocated it in the law of Moses, Slavery was used as a form of privatised prison with a maximum sentence of 6 years of Deuteronomy 15 and as the original form of privatised social services. | Men and women should not be slaves to each other. They should be slaves to the state. |
FINANCIAL FREEDOM | 25 And Judah and Israel continued to dwell in security, everyone under his own vine and under his own fig tree, from Dan to Beer-sheba, all the days of Solomon. (1 Kings 4 NWT) 21 And they will certainly build houses and have occupancy; and they will certainly plant vineyards and eat [their] fruitage. (Isaiah 65 NWT) |
In woke globalist ideology we will all own absolutely nothing and then supposedly be happy. But that is quite obviously a lie. If we own nothing we will be miserable and unhappy until justice and fairness are restored and the Bishops of wokeness return to the people what they have stolen from every one of us. If we work and receive no fruits of our labour then we are slaves with no release. That is an injustice and injustice always leads to pain suffering and misery. |
Drug companies are not going to fund research into the benefits of natural immunity. Neither will health departments or politicians who act as if they are owned by those drug companies. But if you have an oil well in your back garden things are rather different. So the Qataris have done the necessary research. https://www.medrxiv.org/content/10.1101/2022.07.06.22277306v1.full
Nearly 90% of Qatar’s population are expatriates from over 150 countries. Data was taken from the Qatari National digital-health information platform - which is nationally comprehensive containing all relevant Qatari data. This was not a sample of data. It was all of it. Here are the stated results of the paper... .
RESULTS Effectiveness of pre-Omicron primary infection against pre-Omicron reinfection was 85.5% (95% CI: 84.8-86.2%). Effectiveness peaked at 90.5% (95% CI: 88.4-92.3%) in the 7th month after the primary infection, but waned to ∼70% by the 16th month. Extrapolating this waning trend using a Gompertz curve suggested an effectiveness of 50% in the 22nd month and <10% by the 32nd month. Effectiveness of pre-Omicron primary infection against Omicron reinfection was 38.1% (95% CI: 36.3-39.8%) and declined with time since primary infection. A Gompertz curve suggested an effectiveness of <10% by the 15th month. Effectiveness of primary infection against severe, critical, or fatal COVID-19 reinfection was 97.3% (95% CI: 94.9- 98.6%), irrespective of the variant of primary infection or reinfection, and with no evidence for waning. Similar results were found in sub-group analyses for those ≥50 years of age.
I tabulated these findings together with a further Qatari paper on the waning of vaccine efficiency for comparison
https://www.nejm.org/doi/full/10.1056/nejmoa2114114 A study in Qatar into the effectiveness of the Pfizer mRNA jab (Table 2).
Month | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 7+ | 14 | 15 | 16 | 22 | 32 |
Pre Omicron infection against pre Omicron reinfection | 85.5 | 90.5 | 70 | 50 | 10 | ||||||||
Pre Omicron infection against Omicron infection | 38.1 | 10 | |||||||||||
Any Covid19 infection against any severe, critical or fatal Covid19 reinfection | 97.3 | 97.3 | 97.3 | ||||||||||
Pfizer vaccination against any severe, critical or fatal Covid19 infection (Table 2) | 96.0 | 96.8 | 94.3 | 83.7 | 100 | 88.9 | 55.6 | ||||||
Pfizer Vaccination against any Covid-19 infection (Table 2) | 77.5 | 73.2 | 69.6 | 51.7 | 22.5 | 17.3 | 22.3 |
So natural immunity provides non waning 97.3% long term protection against severe, critical or fatal infection for at least 14 months and by extrapolation - indefinitely. Whereas mRNA vaccine immunity wanes to 55.6% at some time after 7 months. Perhaps around 12 months? The Expose has repeatedly shown from UK figures that vaccinated people are more likely to die than unvaccinated people from Covid and we know that almost all unvaccinated people now have natural immunity. There is actually a Qatari paper which reluctantly reaches the same conclusion.
https://www.nature.com/articles/s41467-022-30895-3 Pfizer and Moderna "Vaccine effectiveness (against infection in Qatar) reached small but statistically significant negative values at 7 months or more after the second dose".
So these figures are flattering to the vaccines which are deliberately not investigated much after 6 months. But the key takeaway is that natural immunity does not wane at all in its capacity to save your life. Not by one percent and not in 14 months. So something unusual is occurring in the case of vaccine immunity. One can also see this from the latest worldwide cases and deaths and booster stats...
India has had the slowest vaccination campaign and has only just started at the boosters. It has by far the fewest cases and deaths per million despite being the home of the Delta variant. Whereas Germany, with the highest booster take up, has the highest case rate and until recently the highest death rate too.
So we see that 2.7% of naturally immune Qataris versus 44.4% of Pfizer vaccinated Qataris got severe to fatal infections in the period 7 months after the 2nd vaccination (or the unvaccinated infection). This means that natural immunity is over 16x better at protecting Qataris against severe to fatal infection than Pfizer at 7 months or more after first protection.
The question is why? Why does Pfizer vaccine protection against severe to fatal infection diminish after 6 months in circumstances where natural protection does not diminish at all in 14 months?
The natural immunity figures show categorically that the body does not forget the lessons it has learned from seeing the pathogen. So either the vaccines are not showing the body enough of the Pathogen (the spike protein contains merely 12½% of all the proteins in Covid19) and the pathogen is mutating so as to get around the vaccine, or the vaccine is disrupting the immune system progressively with time. We know from initial infection (rather than severe infection) figures above and in general that the vaccines wane in protection very quickly, in a matter of weeks against the same variant. So the waning is not due to the variant changing its spike proteins and thereby evading the vaccine. So it must be due to the vaccine disrupting and degrading the immune system.
The initial infection rate figures showed very clearly in October 2021, that the vaccines were progressively damaging the immune system capability to resist initial infection week on week. But the human immune system is a marvellous machine. It has layer upon layer of defence against pathogens. So it was conceivable that the vaccines only damaged the first layer of defence against initial infection but did not damage the last layer of defence against severe, critical or fatal infection. Indeed that is the lie that has been peddled by the vaccine makers and the mainstream media and the governments of the world ever since the vaccines were found to be ineffective against initial infection and exposed as such in this very publication.
The latest version of this deception, as delivered by Tony Fauci, goes like this...
DR. FAUCI: One of the things that's clear from the data [is] that even though vaccines - because of the high degree of transmissibility of this virus - don't protect overly well, as it were, against infection, they protect quite well against severe disease leading to hospitalization and death. And I believe that's the reason, Neil, why at my age, being vaccinated and boosted, even though it didn't protect me against infection, I feel confident that it made a major role in protecting me from progressing to severe disease. - https://www.foxnews.com/media/fauci-admits-covid-19-vaccines-protect-overly-well-infection
Evidently Tony Fauci is not familiar with the Qatari data. If he has indeed been doubly vaccinated and doubly boosted as well (having had a total of 4 vaccinations), then yes. He has categorically confirmed that the vaccines do not protect against infection for long (however many jabs you supposedly subject yourself to). But since vaccines cause long term progressive damage to the immune system. He would have been better off had he taken none of them.
Vaccines provide 16x less protection against severe, critical or fatal infection in Qatar, than does natural infection from 7 months into the protection. Fauci claims to have tested positive for the first time on June15 2022. Given his role in life (or more accurately I should say in death) and given that nearly every unvaccinated person now has natural immunity and given that vaccinations even according to Fauci himself are no good at preventing infection and actually according to data in the England. Scotland, Canada, Denmark, Germany, Australia etc increase the chances of infection, the writer finds that claim impossible to believe - unless he has never tested himself before even when he caught Covid19..But in that case he is a rank hypocrite for advising everyone else to test themselves repeatedly.
So now we can see that vaccine immune system degradation VAIDS (Vaccine Acquired Immune Deficiency Syndrome), does not apply only to the first line of defence in our immune system. It eventually compromises our last line of defence as well. It compromises us to the point where we are 16x worse at preventing severe or critical or fatal disease than we would have been with natural infection (which presents the pathogen to our immune system database but does not reprogram our genes at a cellular level). The expose has published several articles proving this from death ratios between the vaxxed and the unvaxxed in several countries immediately before those countries then ceased publishing the incriminating data.
So we knew that the vaccines were defeating the entire immune system and it looked like this was due to VAIDS. The Qatari study shows that it is due to VAIDS. Because:
"Your immune system does not itself lose any immunity ever (however it acquires it). No. Immunity has to be taken away from it by force - by a pathogen (like HIV). The vaccines are therefore such a pathogen."
Your immune system does not know whether it was presented with viral proteins from a vaccine or from natural infection. So it does the same thing in both cases. It puts the pathogenic proteins in the database - permanently. It does not forget them - ever.
So the vaccine waning narrative is a scientifically false cover story designed to hide the pathogenic nature of the vaccines which give specific immunity to Wuhan Hu1 against which they were designed and then actively and progressively destroy every layer of protection that your immune system has to fight all viruses including Covid19, for which destruction they must also have been designed. The body of course fights back. And the data for one jab have never really shown much damage. But the more jabs you have the more damage to your immune system you do. This is not caused by John Wayne, by Bruce Wayne, by Wayne Rooney or by Constable. It is caused by a pathogen which is disguised as a vaccine. The vaccination component finishes its activity after 14 days, when one is regarded as being vaccinated. After that time there is nothing left to wane or wayne or wain. There is instead a Trojan, which continues its work after the 14 day vaccination has ended. This pathogen is the real purpose of the Pfizer and Moderna jabs. Just as the soldiers in the Trojan horse were the real gift to Troy from the Greeks - Not the horse of wood.
In Virgil's Aeneid, after a fruitless 10-year siege, the Greeks at the behest of Odysseus constructed a huge wooden horse and hid a select force of men inside, including Odysseus himself. The Greeks pretended to sail away, and the Trojans pulled the horse into their city as a victory trophy. That night the Greek force crept out of the horse and opened the gates for the rest of the Greek army, which had sailed back under cover of night. The Greeks entered and destroyed the city of Troy, ending the war - https://en.wikipedia.org/wiki/Trojan_Horse
In the same way today, these gene altering vaccines (which scripturally, being the snake bite of Genesis 3:15, may contain the transcription factors for Cain himself, the seed of the Serpent - whose name means spike/spear in Hebrew), open the gates of your immune system to the real pathogenic force that is going to attack mankind. Not Covid19. But the plague of the 4th horseman of the apocalypse of Revelation 6:8, whose name is death, who is Satan2, who is Cain (the resurrected human son of Satan1). Because the originator of war between brothers who invited his brother Abel onto the first battlefield of mankind, to determine by military conflict rather than by divine approval, which one of them was the mightier, is also the architect of the last war that mankind fights, which is fought against us all, with deliberately engineered famine (which we are already seeing), with the final plague (which is yet to come but is already promised by the usual bad actors) and with the long sword (of nuclear weapons, threatened on a weekly basis by the Kremlin). The purpose of this war is once again to replace divine approval for salvation with heartless murderous prowess as the measure of mightiness.
Now the main nuclear weapon in this war which threatens the West is called the Satan2 missile. Because the demons love to hide things in plain sight, in order to prove to themselves just how thick and naive we all are and just how brilliant they are at deceiving us low life. You have heard it said that many who are first will be last and the last first. One of those many is Cain. The first to start a war and the last, the one who starts WW3, the one hidden in the Trojan of the vaccines like Odysseus. For the history book on the shelf, is always repeating itself, says the poet, Bjorn. And there is nothing new under the Sun says the wise man, the prophet, Solomon.
And not only are the gates of your immune system opened up to the plague which is yet to come. But the gates to your genetic ancestry are opened up to a father that you never had, Cain, the firstborn human son of Satan1, the seed of the Serpent of Eden. Yes. It is the ultimate identity theft! You may have been recruited to the enemy of mankind without even knowing it. That is how dangerous gene access really is to your physical and your spiritual life. It is unimaginably dangerous.
If you think I am making unjustifed or fanciful connections here ask yourself this question. What does the 4th horseman of the apocalypse ride? A horse. What did Odysseus ride in? A horse. And just as the Greeks carried out their entire deception by night. So today, the entire deception is cloaked in the darkness of censorship on every mainstream media platform in the entire world
On these matters I must recommend a brilliant Royal Society speech by Mark Kotter from bit.bio. He shows that by changing a maximum of 6 transcription factors, one can change a skin cell into a brain cell or a liver cell into a muscle cell and one can grow young or old cells of any type to order. The implications of this are too enormous to contemplate. But his work demonstrates that one could also change the genetic parental ancestry of a cell whilst maintaining the cell type and function if that was one's goal - https://www.youtube.com/watch?v=jrVQXHmxH7Y&t=5s
We predicted in October of 2021 that vaccinated people would have VAIDS by the end of the year. We deduced that from the 5% increase in initial infection rates in the doubly vaccinated every week compared to the unvaccinated. So that was an immune deficiency in our first line of defence only (which attempts to prevent initial infection). The results of this type of VAIDS have been these ridiculous surges in Covid19 infections right in the middle of summer when people do not normally get the flu. What the Qatari data shows, and what any trained virologist or immunologist is taught ab initio, is that acquired immunity does not wane (other than through HIV or some immune disorder). Our immune system database does not slowly corrupt itself on a week by week or month by month basis. A true vaccination lasts a lifetime (unless it is attacked by an immunity compromising agent). Because it properly mimics the infection which it presents to the immune system.
The manifestations of this first line of defence VAIDS have been...
1. Increases in typical viral infections such as Herpes, Shingles, Hepatitis and multiple simultaneous viral infections (one of the side effects of HIV) - https://expose-news.com/2022/06/17/usa-gov-covid-vaccine-risk-shingles-4925percent/
2. Unseasonal surges in Covid19 infections.
3. Monkeypox increasing in gay men to the point of 400 cases per day worldwide (Ourworldindata) - https://expose-news.com/2022/06/24/monkeypox-only-countries-pfizer-vaccine-great-reset/
But the manifestations of last line of defence VAIDS are...
1. Sudden Adult Death Syndrome (SADS) - https://expose-news.com/2022/06/22/sads-renamed-death-by-covid-vaccination/
2. Increases in sepsis cases (a failure of the immune system to defeat a systemic pathogen) - https://expose-news.com/2022/06/13/fully-vaccinated-children-suffering-autoimmune-disease/
3. Increases in certain types of Cancers - https://expose-news.com/2022/07/04/evidence-covid-vaccines-cause-ai-d-s/
SADS is a term used internationally for deaths for which the post mortem does not reveal any obvious cause of death. In other words it is a new cause of death resulting from a new phenomenon which applies worldwide. Well what worldwide medical intervention has occurred of late? Can you think of one? Does anything come to mind?
In January of this year, I predicted on the basis of exponentially increasing heart attack rates among professional football players during soccer games, that this year would see 62.3 million cardiovascular deaths due to vaccine damage worldwide (not just in soccer players but in all of us). But the exponential rise in these deaths stopped in the first quarter of 2022, the minute I had made the projection actually. This was mainly because booster take up ground to a halt when Omicron took over and became a natural vaccine, far more effective than Pfizer or Moderna at both preventing infection and preventing severe, critical or fatal disease. Even Bill Gates acknowledged that in February. What this means is that the body does eventually kill all vaccinated cells (hopefully without killing you). And whilst heart muscle cells and brain cells cannot be replaced, if you can survive the attack by spike proteins long enough for your immune system to destroy every single vaccinated cell, then your heart damage and brain damage will stop getting worse. Putting this simply. If you stop taking the boosters you will stop damaging your heart and your central nervous system and your cardiovascular system.
So the spike protein cardiovascular damage does slow down and stop eventually. But the immune system degradation appears to continue to progress. The trouble is that one cannot get drug company money to do the necessary research. One has to have an oil well in one's back garden to fund such clinical trials! Go Qatar!
Every year, flu jabs are updated to cover the latest variants of the flu virus. But Covid shots have not been updated at all since 2020. They all target the original 2019 strain, Wuhan Hu1. Why is this?
The CDC in the US says: " There are many different flu viruses and they are constantly changing. The composition of U.S. flu vaccines is reviewed annually and updated as needed to match circulating flu viruses. Flu vaccines protect against the three or four viruses (depending on the vaccine) that research suggests will be most common".
Here are the updates they made each year for the last 4 years.
For 2019-2020, trivalent (three-component) vaccines are recommended to contain:
A/Brisbane/02/2018 (H1N1)pdm09-like virus (updated)
A/Kansas/14/2017 (H3N2)-like virus (updated)
B/Colorado/06/2017-like (Victoria lineage) virus
Quadrivalent (four-component) vaccines, which protect against a second lineage of B viruses, are recommended to contain the three recommended viruses above, plus B/Phuket/3073/2013-like (Yamagata lineage) virus.
FDA’s Vaccines and Related Biological Products Advisory Committee (VRBPAC) chooses the flu vaccine viruses for the United States. For 2019-2020 vaccines, they selected the H1N1 and B components on March 6, 2019.external icon Selection of the H3N2 component was delayed until March 22, 2019.
Were there any changes to the 2020-2021 Northern Hemisphere vaccines from what was included in 2019-2020 U.S. flu vaccines?
Yes, 2020-2021 flu vaccines were updated to better match the flu viruses that were expected to circulate in the United States.
The egg-based H1N1 vaccine component was updated from an A/Brisbane/02/2018 (H1N1)pdm09-like virus to an A/Guangdong-Maonan/SWL1536/2019 (H1N1)pdm09-like virus.
The cell- or recombinant-based H1N1 vaccine component was updated from an A/Brisbane/02/2018 (H1N1)pdm09-like virus to an A/Hawaii/70/2019 (H1N1)pdm09-like virus.
The egg-based H3N2 vaccine component was updated from an A/Kansas/14/2017 (H3N2)-like virus to an A/Hong Kong/2671/2019 (H3N2)-like virus.
The cell- or recombinant-based H3N2 vaccine component was updated from an A/Kansas/14/2017 (H3N2)-like virus to an A/Hong Kong/45/2019 (H3N2)-like virus.
The B/Victoria lineage vaccine component was updated from a B/Colorado/06/2017 (B/Victoria lineage)-like virus to a B/Washington/02/2019 (B/Victoria lineage)-like virus.
The B/Yamagata lineage vaccine component was not updated.
For 2021-2022, recommendations were made for egg-based, cell-based, and recombinant flu vaccines as listed below:
Egg-based vaccine composition recommendations:
an A/Victoria/2570/2019 (H1N1) pdm09-like virus;
an A/Cambodia/e0826360/2020 (H3N2)-like virus;
a B/Washington/02/2019- like virus (B/Victoria lineage);
a B/Phuket/3073/2013-like virus (B/Yamagata lineage)
Cell- or recombinant-based vaccine composition recommendations:
an A/Wisconsin/588/2019 (H1N1) pdm09-like virus;
an A/Cambodia/e0826360/2020 (H3N2)-like virus;
a B/Washington/02/2019- like virus (B/Victoria lineage);
a B/Phuket/3073/2013-like virus (B/Yamagata lineage).
These recommendations include two updates compared with 2020-2021 US flu vaccines. Both the influenza A(H1N1) and the influenza A(H3N2) vaccine virus components were updated. Compared with the Southern Hemisphere flu vaccine recommendation, this recommendation represents one update and that is to the influenza A(H3N2) component.
A few things are different for the 2022-2023 influenza (flu) season, including:
The composition of flu vaccines has been updated.
For the 2022-2023 flu season, there are three flu vaccines that are preferentially recommended for people 65 years and older. These are Fluzone High-Dose Quadrivalent vaccine, Flublok Quadrivalent recombinant flu vaccine and Fluad Quadrivalent adjuvanted flu vaccine.
No changes were made to the A(H1N1)pdm09 or the B/Yamagata egg-based, cell-based, or recombinant vaccine recommended components. The recommended A(H3N2) component was changed to an A/Darwin/9/2021 (H3N2)–like virus for egg-based vaccines and an A/Darwin/6/2021 (H3N2)–like virus for cell-based or recombinant vaccines. The B/Victoria component recommendation was changed to a B/Austria/1359417/2021–like virus (3,4). The clade and subclade for the recommended vaccine strains were 6b.1A.5a.2 for A(H1N1)pdm09, 3C.2a1b.2a.2 for A(H3N2), V1A.3a.2 for B/Victoria, and Y3 for B/Yamagata.
So the regular flu shots have been updated every year to match the prevalent variants in circulation.
But there have been no updates for Covid-shots since the first vaccine which was designed against Wuhan Hu1 of 2019. But Wuhan Hu1 was computer generated. It was not isolated from an infected human host as we shall prove below..
At this point for the benefit of the sceptical reader who may not believe that the Covid-19 virus exists or may not believe that any viruses exist at all I say this.
NIH Virus Definition: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA) surrounded by a protein coat. A virus cannot replicate alone; instead, it must infect cells and use components of the host cell to make copies of itself. - https://www.genome.gov/genetics-glossary/Virus
My More General Virus Definition: A virus is a piece of hacking code in a case which provides entry into a host which it reprograms with said hacking code.
Computer viruses exist because mankind knows how to hack the Windows operating system. Mankind developed the capability to hack our genetic operating system, which builds our bodies, around 40 years after Crick and Watson finalised the structure of DNA in 1953. Dr Robert Malone managed to provide entry of synthetic RNA into cultured human, mouse, rat and fly cells in 1989 using a lipid case for the RNA. So by the early 1990s mankind was in a position to create genetic viruses and coincidentally Windows 95 appeared in the mid 90s along with various computer viruses. I remember my first computer virus infection occurred around 1993. The idea that mankind would invent computer viruses and not invent genetic viruses is a non starter. If the mountain is there, somebody is going to climb it. So we certainly have man made genetic viruses, just as surely as we have man made computer viruses. ,
The mRNA (Pfizer and Moderna) and the DNA (Astra Zeneca and Johnson & Johnson) vaccines are themselves viruses in the sense that they infect human cells and reprogram them . They differ from natural or man made viruses only in their inability to replicate themselves using a host. They program the cells they infect to make spike proteins, not further copies of the vaccine which is spike protein RNA or DNA in a nanolipid or an adenovirus vector. Whereas viruses reprogram your cells to make further copies of themselves. Of course once you can genetically reprogram cells you can get them to make whatever you want that is within their capability.
If you do not believe that mankind can reprogram cells genetically then you do not believe in the vaccines, for that is what they do. That is how they get your body to make the spike proteins.
Knowing that the vaccines are unable to program your cells to make further copies of themselves, the Pharma companies instead loaded the doses of the jabs to contain absolutely massive initial numbers of the spike protein DNA or RNA genomes, Pfizer has around 14 trillion copies and Moderna has around 48 trillion copies. So they get around the inability to replicate by injecting as many copies as one would ever need at the start. I say all this because if you do not believe in the existence Covid-19 virus then neither can you believe in the existence Covid-19 vaccine which is essentially the same as the virus in its effect. Actually it is far worse than the virus in its effect and provides more spikes than does a lethal virus infection (around 100 billion) and it provides spikes for a far longer time (6-12 months) than a Covid19 infection does (7-14 days)
Antiretrovirals have extended the life expectancy of AIDS sufferers from less than 10 years to close to the normal length. They have saved millions of lives. They result from Prof Luc Montagnier’s discovery of the HIV virus for which he was given the Nobel prize in 2008.
https://ourworldindata.org/art-lives-saved
If you deny the existence of viruses you deny the result of the anti retroviral treatment they are getting (HIV is a retrovirus), and you thereby condemn to death everyone with AIDS. Your denial, if accepted by the medical community, would kill around the same numbers of people as the vaccines.
That makes you as bad as Fauci, Daszak, Baric Moderna, Pfizer, Bill Gates and all the other vaccine pushers.
Vaccine pushers will kill tens of millions
Virus denial would actually kill more given all the viruses out there including HPV, Hepatitis etc,.
I have a social friend who now runs a pharma company (Excalibur) who put a cancer torpedo in a herpes virus and cured cancers in a clinical trial and sold his research vehicle to Amgen for a billion dollars. The drugs resulting from his work have been available since around 2015, I think,
Imlygic. Oncovex. T-VEC
https://pubmed.ncbi.nlm.nih.gov/27516203/
https://pubmed.ncbi.nlm.nih.gov/27407058/
I mean if there was no Herpes simplex virus then he would have no product. But his Herpes Virus cancer torpedo cure has been approved all over the place. On a personal note. I have Herpes simplex. It is infectious. I caught it from a girlfriend.
Missing RPE65 gene. Gene Therapy for Leber congenital amaurosis is to add that gene back to one's DNA by direct injection in a modified adenoassociated virus into the eye (just like Astra Zeneca or Pfizer). The eye keeps that DNA and eyesight improves from almost blind to perfect in most children in a few months.- Unnatural Selection Netflix. - https://medicaltrend.org/2021/04/14/viral-vector-based-therapeutic-drugs-for-genetic-diseases/
Leber congenital amaurosis (LCA) RPE65 Gene therapy has lasted for 4 years and is still working in treated patients. It was FDA approved in 2018. So it has only had 4 years of application so far. Since it is DNA in a viral vector it will last as long a AZ lasts and vice versa.
Here is a good letter about the nucleocapsid protein vaccines quoting papers showing that natural immunity or dead whole virus immunity is better than spike protein immunity - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7459553/
Jacob Glanville, PhD, Founding Partner, CEO, and President, of the privately funded biotech company, Distributed Bio, produced a Universal flu vaccine containing all previous flu viruses. Works in pigs. Gates refused to fund it.
https://www.lordswitnesses.net/downloads/Montagnier1.pdf contains shedloads of isolates from humans and animals of HIV, SARS-CoV-2 etc.
But my favourite proof of the existence of pathogenic viruses are the Covid-19 vaccine themselves. the DNA vaccines (Astra Zeneca and J &J) are spike protein DNA inside a monkey adenovirus. If there are no viruses, then there are no DNA vaccines.
If we define a virus as a piece of hacking code in a case with a delivery mechanism into a host. Then this definition works for both computer viruses and human viruses.
By this definition, the vaccine is a virus. And it causes for example myocarditis, which is now a well known medical condition that even the governments accept is a result of the vaccines. So Myocarditis is a form of Vaccine-itis.
Of course the vaccines are infectious only in the sense that the government makes them so by continually injecting people.
If one insists that a virus must be self replicating. Then the vaccine are partial viruses not full viruses because they are not self replicating (unless they actually program the cell to make both spike proteins and more spike protein RNA which is possible actually. That would make them into self replicating viruses). But certainly they enter a cell and reprogram it to make the spike protein part of the virus which is 12½% of the proteins in the virus. They could plainly just as easily reprogram the cell to make the entire virus genome and all its proteins. It they did that then the vaccines would be self replicating viruses - which Virus deniers refuse to accept exist. But plainly if a cell can be reprogrammed to make the spike protein part of a virus, then they can also be reprogrammed to make the rest of the parts of the virus, whether that virus is naturally occurring in vivo or made made on a computer in silico or man made in a lab in vitro.
So the flu jabs are updated every year in order to match the current variants of the flu.
Here is the timeline of the variants of concern given Greek letters (for reasons of political correctness in order not to stigmatise the countries which produced them) by the WHO. - https://www.ecdc.europa.eu/en/covid-19/variants-concern
WHO label |
Lineage + additional mutations |
Country first detected (community) |
Spike mutations of interest |
Year and month first detected |
Rationale for de-escalation |
---|---|---|---|---|---|
Wuhan Hu1 |
China |
December 2019 |
Not even considered in the WHO Greek letter naming system - Irrelevant by 2021. |
||
Alpha |
United Kingdom |
N501Y, D614G, P681H |
September 2020 |
Drastically reduced circulation in the EU/EEA following the emergence of Delta; little evidence of impact on vaccine induced immunity |
|
Epsilon |
USA |
L452R, D614G |
September 2020 |
No longer detected or detected at extremely low levels in the EU/EEA and available data indicating that vaccines and treatments are effective against such variant |
|
Eta |
Nigeria |
E484K, D614G, Q677H |
December 2020 |
No longer detected or detected at extremely low levels in the EU/EEA |
|
Theta |
The Philippines |
E484K, N501Y, D614G, P681H |
January 2021 |
No longer detected or detected at extremely low levels in the EU/EEA |
|
Kappa |
India |
L452R, E484Q, D614G, P681R |
December 2020 |
No longer detected or detected at extremely low levels in the EU/EEA |
|
Iota |
USA |
E484K, D614G, A701V |
December 2020 |
No longer detected or detected at extremely low levels in the EU/EEA |
|
Zeta |
Brazil |
E484K, D614G |
January 2021 |
No longer detected or detected at extremely low levels in the EU/EEA |
|
Mu | B.1.621 | Colombia | R346K, E484K, N501Y, D614G, P681H | January 2021 | No longer detected or detected at extremely low levels in the EU/EEA |
Lambda | C.37 | Peru | L452Q, F490S, D614G | December 2020 | No longer detected or detected at extremely low levels in the EU/EEA |
Beta | B.1.351 | South Africa | K417N, E484K, N501Y, D614G, A701V | September 2020 | No longer detected or detected at extremely low levels in the EU/EEA |
Gamma | P.1 | Brazil | K417T, E484K, N501Y, D614G, H655Y | December 2020 | No longer detected or detected at extremely low levels in the EU/EEA |
Delta | B.1.617.2 | India | L452R, T478K, D614G, P681R | December 2020 | Detected at extremely low levels in the EU/EEA |
Omicron | BA.1 | South Africa and Botswana | (x) | November 2021 | Detected at extremely low levels in the EU/EEA |
Omicron | BA.3 | South Africa | (z) | November 2021 | Detected at extremely low levels in the EU/EEA |
The original strain Wuhan Hu1, was never given a Greek letter. It was pre alpha. This was because it had died out completely before the WHO devised its lettering system for variant names..
So looking at the table above, what should have happened, had Covid-19 vaccines followed the normal vaccination updating procedure, is that in late 2020 a trivalent vaccine should have been made coding for the proteins of Alpha, Beta and Epsilon. Then in 2021 a quadravalent vaccine coding for Alpha,. Beta, Epsilon and Delta. Then in 2022 a bivalent vaccine should have been made coding for Delta and Omicron.
Furthermore, knowing how pathogenic the spike proteins were, the vaccines should have been coding for viral nucleocapsid (case) proteins rather than their spike proteins.
But none of that occurred. Instead everyone was jabbed with a vaccine for Wuhan Hu1 1,2,3 or 4 times. The vaccines were not introduced until December 2020, by which time Wuhan Hu1 had almost vanished. So to date, nobody has been vaccinated for the correct variant. What is more absurd is the case of the Novavax vaccine.
This vaccine is not a gene therapy, although it is produced by gene therapy using a baculovirus. They make the vaccine by doing to a moth what the DNA and mRNA vaccines do to a human, and then harvesting the resulting spike proteins. Funny how they are happy to call it 'established genetic engineering' when it is done to a moth but pretend it is not genetic engineering when it is done to a human. The Novavax site states
| Novavax vaccine development: from established genetic engineering to unique nanoparticle
| The recombinant antigen proteins are harvested from the surface of the Sf9 cells, purified, and arranged around a nanoparticle core.
But wait a minute. What are the spike proteins doing on the surface of the cell? They are supposed to stay inside the cell and not enter into the blood stream outside the cell. Oh dear. They have escaped! They are being harvested!
The mere existence of the Novavax vaccine proves that Wuhan Hu1 spike proteins do NOT have a transmembrane anchor which keeps them locked inside vaccinated cells. No. They escape from every single vaccinated cell to the outside of that cell in order that they can be harvested. For what they are doing in moth cells, they are also doing in human cells. They get harvested into your heart, your brain, your ovaries, your testicles, your liver, your spleen and your entire cardiovascular system. Your body is the barn for that harvest. They even infect your immune cells, which then infect your lymph glands. From there they infect your entire body. In fact your immune system is the primary infection target. Your T cells become you own personal grim reaper for spike proteins.
The mRNA and DNA vaccines make you into the genetically engineered moth, churning out spike proteins to be harvested by your T cells into every vital organ of your body
Novavax contains neither DNA or RNA. So one might think great. Al last we have a safe vaccine right? Wrong. It contains the Wuhan Hu1 spike protein in massive numbers manufactured by those genetically reprogrammed moths. It was only approved a few months ago. So why does it not use the Delta or an Omicron spike protein? There is absolutely no point in vaccinating yourself in late 2022 against the original strain of the virus which disappeared as a pathogen at the end of 2020. Why are they using the wrong spike protein? Why is everyone using the wrong spike protein? Why are they using spike proteins at all which they know make up only 12½% of the total proteins in the virus, in circumstances where the other 87½% are less pathogenic?
I have been asking myself the above questions for some time. Why have the Covid vaccines not been updated? Why do they only code for the spike proteins and not for other viral proteins that one would get from natural immunity? I found the answer with this new Moderna vaccine, that is supposed to tackle the Omicron variant. Guess what it codes for? It is bivalent. It targets the original strain Wuhan Hu1 and Omicron BA.1.
Let me be clear. There is absolutely no medical reason to target the original Wuhan Hu1 strain in late 2022. Because it died out in late 2020 (if it ever existed at all). The vaccine should have targeted Delta and Omicron. It's not like they did not know about Delta which came before Omicron.
So now we see the true purpose of all of the vaccines laid bare. Yes every single one of them has the same common factor. They all are designed to get the original Wuhan Hu1 spike into your body. But wait a minute. That must have also been the purpose of the original man made Covid 19 virus, which the vaccines reproduce. We know that Covid-19 (SARS-CoV-2) was man made because the only non trivial difference between its RNA and the RNA of the RaTG13 Bat Coronavirus is the 12 Base insert containing a double CGG codon which does not exist in any virus occurring in nature.
So the true purpose of Covid-19 was to infect your body with the Wuhan Hu1 spike protein. And the true purpose of the vaccines is to do precisely the same thing. You will never see any Covid-19 vaccine that does not code for (target) the original spike protein (however pointless such a vaccine now is). At this late stage in the con, we can finally see what the power game was all about. It was about getting as many Wuhan Hu1 spike proteins into your body as possible.
Here is where the conspiracy theories start. Take your pick. They are not mutually exclusive.
1. The Wuhan Hu1 spike is a Trojan, which destroys the antiviral part of your immune system and opens the door to a future more lethal virus which will lead to mass depopulation.
2. The Wuhan Hu1 spike is a Trojan, which destroys your immune system, in order to make you totally reliant on pharmaceutical immunity in order to keep living into the future. Your immune system stands in the way of big Pharma profits.
3. The Wuhan Hu1 spike protein is a genetic hack which changes your genetic ancestry from being a child of God through Adam, to being a child of Satan through Cain. It is the fulfilment of Genesis 3:15. Its purpose is to keep you under Satanic rulership when Satan's lease over mankind expires and to deny you salvation. It is a demonic hack of your genes.
4. The Wuhan Hu1 spike is an attack upon your mind body and spirit to soften you up for the globalist assault upon your freedoms, your identity, your character and your love for mankind
One has to be really careful in one's thinking here in order to piece this puzzle together correctly. SARS-CoV-2 has been isolated from humans. But the original Hu1 strain was not so isolated. It was computer generated. One can easily see this from the NIH records for SARS-Cov-2 genomes...
Wuhan Hu1 Reference Genome: These two entries in the GenBank are identical:
NC_045512.2: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1,
complete genome - source - not given, December 2019 (29903 nucleotides)
MN908947: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome -
source - not given, December 2019 (29903 nucleotides)
1805293611: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-01/2020, complete genome source - male age 65, 23 December 2019 (29899 nucleotides)
MT019530: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-02/2020, complete genome - source - female age 49, 30 December 2019 (29899 nucleotides)
MT019531: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-03/2020, complete genome - source - male age 41, 30 December 2019 (29899 nucleotides)
MT019532: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-04/2020, complete genome - source - female age 62,, 30 December 2019 (29890 nucleotides)
MT019533: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-05/2020, complete genome - source - male age 61, 1 January 2020 (29883 nucleotides)
So the NIH database itself reveals that the original Hu1 reference strain, was not isolated from a human host because no isolation date is given and no specific person is specified as the host. Whereas in the other 5 entries for SARS-CoV-2 from Wuhan, a person is actually specified in the database as the source, together with a sample collection date. So the reference strain that is used to generate every vaccine is not a real virus. It is a synthetic computer generated virus. For if it had been isolated from a human, then the database would describe that human. But it does not.
So this answers 2 questions. Has SARS-CoV-2 even been isolated - YES. Was the original strain of Wuhan Hu1 isolated - NO. Steve Kirsch covers this tricky subject very well in his newsletter on the subject
The problem with the Wuhan Hu1 entry in the NIH database is that it is called an isolate. When it is not. Furthermore the University of North Carolina, Moderna and NIH had a copy of the 1273 amino acid spike protein in November 2019 (at 33 minutes into the video of the interview between Dr. David Martin and Reiner Fullmich). This was before the Wuhan Hu1 computer generated virus appeared according to its entry in the NIH GenBank database.
The final piece of the puzzle is the convincing evidence and confession from Peter Daszak that Peter Daszak, the Eco Health Alliance, Ralph Baric, Shi Zhengli and Moderna made the original strain of SARS-CoV-2 whilst being funded by Fauci, the NIH, the NIAID and the US Government. Do not be fooled. Trump calling Covid-19 the China virus is an intelligence agency smoke screen. The Chinese are essentially subcontract manufacturers for the Americans. And the globalist corrupted US intelligence agencies are covering it all up and spreading disinformation after having been ordered by President total fraud Biden to investigate the origin of the virus and reporting back to him after 3 months that they don't know. Yes what great servants of the public interest they all are!
https://expose-news.com/2022/04/19/covid-is-man-made-a-timeline-of-bio-terror/
There is no question now that the purpose of the man made Covid-19 pandemic and its vaccines was, and is, to infect as many people as possible with as many copies as possible of a computer generated spike protein. And since the whole process was funded by the US deep state which is controlled by globalists, the goal of this gene hack on mankind is a globalist type of goal. That is easy to see because the vaccinations have been global.
The latest bivalent Wuhan Hu1 and Omicron Moderna offering and Wuhan Hu1 Novavax offering provide the final witnesses (if more were needed) that this is not and never has been about health. It is about people at all levels of the public sector and in big pharma and healthcare staff and the main stream media being bribed by globalists to launch an unprecedented attack on the genetics of mankind through a computer generated gene hack called Wuhan Hu1, which is present in every single vaccine but has not been present in any variant of the the virus for nearly 2 years (if it ever was).
They designed the original virus to deliver the Hu1 spike protein
They designed every single vaccine to deliver the same Hu1 spike protein
They destroyed economies and lives with lockdowns to force people to take the Hu1 spike protein
They destroyed jobs, careers, livelihoods and holidays of hundreds of millions of people by vaccine mandates and travel bans to force people to take the Hu1 spike protein
They approved the infection of children as young as 2 with the Hu1 spike protein.
They lied and falsely represented that the vaccines were not gene therapy to increase Hu1 spike protein take up
They lied and falsely represented that the destruction of anti viral immune systems in the vaccinated was ;a 'waning of vaccine efficacy'
They stopped producing government figures in Scotland, England and Denmark when those figures irrefutably showed that the vaccines make people more likely to be infected and more likely to die from Covid-19.
They continue to argue to his day that Covid-19 vaccines are safe and effective,
when there is a mountain of overwhelming evidence that they are unsafe and anti effective.
The vaccines would have been safe and effective had they coded for the 87½% of viral proteins that are not in the spike and had they been updated regularly for real variants rather than Hu1 and had they been of the Novavax type rather than gene therapy.
"The whole process has been a pack of lies designed to fill you up with computer generated spike proteins."
This is a war on your body. Wokeness is a war on your morality and on your family. The politicisation of the green agenda is a war on your food and your energy. The UK and US militaries are being destroyed internally by political correctness. So that rather than having Top Gun or Top Aircraft Carrier Prop Shaft Greaser we now have either Bottom Gun or Diverse Gun or Bottom Greaser (woops).
What amazes me is that the RAF think that by putting mediocre pilots who are ethnically and sexually more diverse (i.e. black, female and non heterosexual) in fighter jets in combat situations, they will help people in those demographics. Can they not see that they will kill those pilots who will be facing opponents who are much better at shooting planes out of the sky than they are? Are they trying to create more funerals for diverse people?
Yes. It is a war on every aspect of our lives. And this is the artillery barrage that precedes WW3. Because war is the most effective power grab any government can have. And the globalists want power, total power, absolute power. Bill Gates did not want to control some of the computers. He wanted to control all of the computers. He did not want to vaccinate some of the people. He wanted to vaccinate all of the people. The globalists do not want to wield some of the power in and over your life. They want to wield all of the power in and over your life. They want to determine whether or not you eat, you sleep, you love, your procreate, you breathe, you crap, you fart or you expire. They want to turn the entire planet into a giant concentration camp, where children are separated from their parents and abused in lethal medical experiments (a prime woke objective, a prime vaccination objective).
The difference between WW2 and WW3 will be the greatly elevated level of consciousness of modern mankind thanks to history books, documentaries, the internet and publications such as the expose. It is not like we have not seen this sort of behaviour before.
"Everyone who has participated in vaccinating others or in pressurising people to be vaccinated or in advising them to be vaccinated or in fabricating data in support of vaccination, or in refusing to publish data which does not support vaccination, or in censoring people who oppose vaccination, or in sacking people who are not vaccinated, or in performing only to audiences who are vaccinated, or in flying or staffing an aeroplane which prohibits unvaccinated people, or in working on a cruise ship which refuses passage to the unvaccinated, is talking the role of the concentration camp guard presiding over lethal medical experimentation on the inmates"
Let me put this simply. The globalists want power over your life and over your body. The globalists want you infected with their spike protein which hacks your genes. Therefore the spike protein gene hack must give them some sort of power over your life and your body.
Q: How does it do that?
A: By changing your genetic ancestry from a child of God through Adam to a child of Satan through Cain (meaning spike/needle/spear/lance in Hebrew). The vaccines give paternal rights over your life and your body to the real globalists, the ones lead by or possessed by the demons. It is the demons who are attacking mankind in so many inhuman ways right now.
The Expose first published this interpretation of Genesis 3:15 on November 28, 2021. It is looking a lot more credible now than it did back then. - https://expose-news.com/2021/11/28/who-is-really-behind-the-vaccine-mandates/
Here is a quick shot at my ideas. None of which I imagine will ever be implemented. Can you do better? I wish the PM every success in fixing what is broken for the benefit of all the people of the UK..
1. Abolish SAGE, JCVI, SPI-M-O, SPI-B, NICE, MHRA and all other medical QUANGOs. Sack the entire NHS administration of every hospital and abolish PHE. They have all have failed the people of this country. Hand control of all medical protocols and hospital finances back to the doctors and nurses and medical researchers from whom it was taken by Margaret Thatcher on the advice of a director of Sainsbury's (Roy Griffiths) in 1983. I am sure he was a very effective grocer but...
2. Take the administration of all road and rail transport away from every local authority and make ONE exclusive national authority for all road and rail transport and parking matters. Transport should be the same in every borough. It is NOT a local phenomenon by definition. Get some of the formula one teams to develop a really efficient 10 kW petrol generator and a small 10 kW 98% efficient electric motor/regenerative brake and use 2 motors one petrol generator and one 10kWhr battery pack to make a highly efficient, very compact, but not particularly powerful hybrid drive train and fit this into all road cars which do not truly achieve 60 mpg in city driving and 80 mpg in motorway driving
3. Treat the Woke cult in precisely the same way that Christian churches are treated. The two are just mirror images of each other. There should be no secular bias in either direction. Permit them both. Favour neither one of them.
4. Criminalise the teaching or promoting of anything to do with sex to minors. Withdraw all funding and accreditation from any school college or university which attempts to force any political, religious, woke, racial, philosophical, or sexual preference on its pupils except in optional courses expressly for that purpose. Force all commercial and public sector outfits to compensate people who are cancelled or sacked because they admit or express a certain opinion with a severance payment equal to the total salary they have earned from that outfit during the last 3 years.
5. Decriminalise hate. It is an emotion to be felt not a crime to be policed. Decriminalise those who cause offence. It is a necessary part of life and of free speech. Instruct the police to go back to targeting real crime not political crime or emotional feelings or sins according to the woke cult..
6. Rebuild the manufacturing base that Margaret Thatcher destroyed. If/when we get into a war with the Chinese, we will not by able to buy anything from them anymore. We therefore must manufacture all essential items here in the UK from UK resources or we are a sitting duck in that war. Transfer people out of the public sector into essential manufacturing to achieve this.
7. Provide 100% employment opportunity to everyone by offering every small company one employee on benefits each (or perhaps one per 10 employees) paid for entirely by the government for the 1st year. Then 75% for the next year, then 50% for the next year. Take the unemployed off their sofas and give them to small companies at no cost to the company. The government never does anything for small companies and yet they drive the economy. Do not have them work for the state. Do not have them sit at home. Have them work for start ups and smaller companies, paid for by the state.
8. Force Google, Facebook, Twitter, Youtube etc, to stop censoring and to provide plain search results which have no medical, scientific, political or religious bias, by requiring them by law to put up a landing page for UK IPs saying something like:
HM Government has evidence that this company is administrated by politically active people with an undisclosed agenda. They label true information as false. They censor, remove and bury true information for political purposes. They persecute subscribers who do not share their narrow political view. All of their assessments as to what is true or false are nothing more than valueless politics. Do you understand the dangers you face by continuing to interact with this corporation?
YES continue NO go back.
Here are some alternatives (which the government should fund if necessary) which offer a better approximation to uncensored plain searches etc.: LYCOS, Duckduckgo, Bitchute, Truth Social etc.
9. .Abolish all UK nuclear weapons. They are the precise opposite of smart bombs. They are suicide bombs. Lead by example, But continue to support Ukraine not to invade Russia but to defend its own sovereign territory honouring our commitment in the Budapest memorandum of December 5. 1994 when Ukraine gave up their nuclear weapons in return for security guarantees from the UK, the US and Russia. Rebuild the Armed forces with some of the savings from abolishing the nuclear weapons. We should have purchased the YF23 from Northrop Grumman McDonnell Douglas when the US military went for the F22 and then the F35. Develop a cheap but effective 6th generation fighter or join the Japanese initiative to update the YF23. Stop buying sitting duck aircraft carriers. Loads of supersonic/hypersonic missiles in nuclear powered subs are a better solution.
10. Ban the entire public sector from charging for any service they provide. And ban them from undertaking or partnering with any form of private sector activity such as property development. Let them concentrate on providing the services they are paid to provide with the taxes they receive, rather than saying: Thanks so much for the tax guys. But now that we have it, we are going to spend all day long not providing the services you have just paid for, but instead leveraging public sector power to compete unfairly with the private sector to earn even more money for ourselves. No more Council-Burger type businesses.
11. Terminate all Intelligence service influence over the mainstream media, over the internet, over healthcare policy and over financial transactions. They are servants not masters. Nobody elected them. They are spies not journalists. Abolish 2 factor ID. It will be used by the globalists to control all financial transactions. Limit Intelligence operations to military and UK terrorist attack threats only. Specifically exclude political, environmental, religious and other activists unless they are a violent physical threat. Open up 25% of BBC programming in prime and non prime time slots to give a platform to alternative media such as the Expose - covering the entire spectrum of political, scientific, philosophical, cultural and religious views. It is supposed represent the entire country not merely its board of left wing historically paedophile friendly governors.
12. Remove the power of parliament to give away any aspect of UK sovereignty to any foreign or domestic group. Trade treaties yes. Political or sovereignty devolution of any type no. Globalism no. European Union no. International tax no.
A Timeline of Royal Vaccination and Health Events
2021January9. The Queen and Prince Philip both receive their first Covid shot
2021February16: Prince Philip is admitted to King Edward VII Hospital with an infection and 'pre-existing' heart problems
2021March3: Prince Philip has a heart operation at St. Barts in London.
2021March16: Prince Philip is discharged from King Edward VII
2021March31 or a few days before: The Queen receives her 2nd Covid shot before her first maskless public appearance at the Royal Australian Air Force Centenary
2021March31-April3: Prince Philip most likely receives his second shot at the recommended 12 weeks after the 1st shot.
2021April9: Prince Philip dies of "Old Age" according to the Royal doctor, Professor Sir Huw Thomas.
2021 Late September: The Queen gets a Winter booster jab - her 3rd shot
2021October21: The Queen missed a reception for business leaders at Windsor due to ill health and spent a night at the King Edward VII Hospital.
It marked her first hospital stay in eight years and led to her being on doctor’s orders to rest between mid-October and February, during which a series of royal engagements were cancelled.
2022February20: The Queen loses her mobility and says: Well, as you can see. I can't move
2022September6: The Queen never recovers her mobility: Liz Truss has to visit HRH Queen Elizabeth at Balmoral to be appointed PM.
2022September8: 12:32 pm: Buckingham palace releases a statement
"Following further evaluation this morning, the Queen's doctors are concerned for Her Majesty's health and have recommended she remain under medical supervision," it says.
2022September8: 12:39 pm: The BBC interrupts scheduled programming with the Palace announcement and launches rolling news coverage of developments.
Presenter Huw Edwards appears dressed in a dark suit, white shirt and black tie, in line with the BBC's dress code for when a member of the royal family dies.
2022September8: 1:00 pm: Prince Charles and Camilla are at Balmoral
2022September8: 1:35 pm Princess Anne arrives at Balmoral
2022September6: 4:00 pm: Queen Elizabeth II dies.
2022September8: 5:05 pm: Prince Andrew, Edward, Sophie and William arrive at Balmoral by car too late..
2022September8: 6.30 pm: Buckingham Palace announces: "The Queen died peacefully at Balmoral this afternoon."
2022September8: 8:00 pm: Prince Harry arrives at Balmoral.
https://www.thesun.co.uk/news/17711929/is-the-queen-vaccinated-against-covid-19/
https://www.hitc.com/en-gb/2021/02/26/which-vaccine-did-the-queen-have/
https://www.thesun.co.uk/news/14515323/queen-second-covid-jab-work-lockdown/
https://www.dailymail.co.uk/news/article-9424795/Queen-94-got-second-Covid-jab-facing-public-without-mask.html
https://www.marca.com/en/lifestyle/uk-news/2022/02/21/62135968268e3ecc3e8b45d5.html
https://inews.co.uk/news/is-queen-elizabeth-vaccinated-what-we-know-covid-vaccine-tests-positive-1472032
https://www.ndtv.com/world-news/queen-elizabeth-ii-death-here-is-the-days-timeline-3328751
https://www.bbc.co.uk/news/uk-56413762
The recommended time between Jabs in early 2021 was 12 Weeks. The Queen and Prince Philip were Monarchs who did their duty. The Queen took her 2nd jab just before March31, which was 81 days (11½ weeks) after her first jab. This was because she had to attend a maskless event on the 31st. Professor Sir Huw Thomas would have been considered negligent according to the prevailing medical wisdom in early 2021, had he not administered the 2nd shot to Prince Philip within 12 weeks. That is by April 3rd. The prince died 6 days after that date. The most likely scenario here is that he died around one week after his second dose.
Prince Philip was admitted to hospital with an infection and a heart condition 38 days after his first Covid shot on January9 and died precisely 3 months after his first shot and probably around 7 days after his 2nd shot. He died at 99 years old, which is pretty good going for a man. But infections and heart problems are classic symptoms of vaccine related disease. One would not normally expect the immune system to be degraded much in 38 days post vaccination, But on the other hand many vaccine related deaths occur in the first 14 days after the shot. Especially within 14 days after the 2nd shot. And that appears to be when Prince Philip died.
Furthermore it is known the vaccines double the chances of a heart attack and cause Myocarditis. The American Heart Association Paper given in a speech by Dr Steven Gundry to the American Heart Association in Boston on 2021 November 12-14 found that mRNA vaccines more than double your 5 year chances of getting a heart attack as measured by various inflammatory markers at 2 months after the 2nd jab The expose covered this in their article on football deaths of 2021 December8.
The Royal Doctor put down Prince Philip's death to 'Old Age'. He might as well have called it 'Old Age Syndrome' or OAS. Of course nobody dies of old age. They die of a medical problem or problems which are caused or exacerbated by old age. The true cause of Prince Philip's death has quite obviously been hidden. That in itself is good evidence that the vaccines played a significant part in his demise.
The death of Prince Phillip would have had a significant effect of the state of mind and therefore on the health of the Queen, who loved her husband. So indirectly the probability is that through the death of Prince Philip, the vaccines played a significant role in the death of our Queen.
The Queen received her 'winter booster' in 2021. There is no point in receiving that after winter has started. So to be safe September/October would be the time to receive it. Winter is the time when the flu is most prevalent due to Vitamin D deficiency amongst other things. The JCVI issued a statement on 2021September14 inviting all over 50s to take a Winter booster shot. Since the Queen was 95 years old at that time, she was very high risk. She also was very keen to set a good example with vaccines stating:
"It's selfish not to have the jab," is how the Daily Mail summarises her message which it describes as "historic" and "astonishing". It says it's "highly unusual for the sovereign to take such a firm public stand on contentious issues".
"Do one's duty," is the Daily Mirror's headline which sees her remarks as a "stern rebuke to anti-vaxxers".
The Daily Telegraph explains that it's been told by royal sources that it's the Queen's "passionately held belief" that everyone should get a jab.
Since the Queen is the epitome of duty and service. She can be expected to have received her booster shot in September 2021, not long after the September14 JCVI recommendation. Then on 2021October21, she was admitted to King Edward VII hospital for the first time in 8 years. The Guardian reported at that time saying
"The 95-year-old is known for her strong constitution and no fuss approach to her infrequent illnesses"
Yes. Infrequent until her 3rd vaccine shot, probably in late September. Whereupon, within a month, she found herself in hospital with her doctor advising her to cancel all Royal duties until February. Then in February she became immobile and caught Covid. Anyone starting to see a pattern here?
Older women can be immobilised by the vaccine. Sometimes the lack of mobility is temporary as is the brain fog that can ensue. And other times it is permanent. It all depends how old and how fit you are when you take the 2nd or 3rd jab. It does not generally happen after the first jab. It most often occurs after the 3rd. Anecdotally of the older women I know who have had a booster, one was fine, the other lost her mobility permanently and semi recovered from the brain fog, and the other lost it temporarily and has now regained it and fully recovered from the brain fog. But she was so worried when she first got the fog.
These vaccines affect the central nervous systems of girls and women and the hearts of boys and men.
Prince Philip most likely died 7 days after his 2nd shot and a month after a heart operation which occurred 7 weeks after his first shot. Whereas the Queen, who would have been seriously damaged by the death of her beloved prince, fell ill for the first time in 8 years immediately after her booster. Then upon medical advice given to her in hospital, she cancelled all her royal engagements until 2022February20, when she lost her mobility and stated that she could not move. If you will pardon the metaphor, the Queen was a tough old bird and her mother was just as tough having died at the grand old age of 101. But there again her mother never had to suffer the indignity of a gene hacking vaccine.
I strongly suspect that Prince Philip might still be and that Queen Elizabeth II would certainly still be alive today, had they not taken a vaccine full of computer generated spike proteins, 2 or 3 times. I think that the vaccines may have done to the Windsors in 2021 and 2022 what the Bolsheviks did to their Russian relatives in 1918. And that is no empty analogy. Because those behind the vaccines are the new Bolsheviks to the entire world.
I therefore call for an urgent and immediate public enquiry into this potential treason upon our royal family and recommend to all royals and commoners alike, that vaccines are unsafe and ineffective. The Queen caught Covid19 5 months after her 3rd booster. That is the time when according to many PHE and Scottish government statistics analysed by the Expose, her immune system would have been severely compromised and working at less than 36% of unvaccinated capacity as regards its effectiveness against Covid and other viruses.
I do commend the Queen for always trying to set a good example and for refusing to be a hypocrite in this matter. I find it tragic that our health service has let her down so badly and conducted a medical experiment upon her health which experiment failed to protect her against Covid and may well have significantly contributed to her death. At 96 years old, her lack of mobility (which is my opinion is very likely to have been vaccine mediated given the proximity of her final illness to her 3rd jab), may well have been the straw that broke the lionesses back.
There was a time when this country would not tolerate an attack upon its monarchy. I hope we are still living in that time. I hope that true scientists will be permitted to investigate this matter fully, for the benefit of the royal line and for the benefit of the health of every citizen of this sceptred isle.
In the meantime, pending that investigation, I hope that people all around the world will learn as much from their vaccine assisted deaths as we have learned from their most colourful and most dutiful lives in public service.
In Honour of Ashli Babbit, Kevin Greeson, Benjamin Phillips and Roseanne Boyland, The 4 MAGA Martyrs of January 6
There have been no presidential elections this century or last century in which the vote count was deliberately STOPPED for hours by election officials in any one state on election night.
There may also have been no presidential elections this century or last century in which sufficient votes had not been counted on election night for an initial winner to be declared on election night. Fact fudging sites such as Snopes have scoured old newspapers looking for examples of states where vote counting was not finished on election night in an attempt to normalise the mechanisms of vote counting fraud. But that does not mean that a winner had not been declared in that state on election night. However no state had deliberately stopped counting votes in a presidential election for hours until 2020. This should be confirmable by TV election night footage certainly from 1948 onwards.
I mean let us be frank here rather than naive. If you permit votes to arrive and be counted after the polls have closed on election night then you enable vote fraudsters to calculate how many votes are needed for their favoured candidate and 'produce' those votes to order. But such calculation and production takes time. So you have to stop the vote counting or slow it down in order to pull off that fraud.
There have been 4 presidential elections in the last 222 years which did not produce a winner on election night. These were 1800, 1824, 1876 and 2000.
In 1876, the election between Rutherford B Hayes and Samuel Tilden was contested because several states refused to certify their election results. But the results came in on election night.
The only presidential election in this century or the last in which the result was not finally declared on election night was the 2000 race between Bush and Gore with the manufactured problem of hanging chads. Gore was declared the winner on election night. But his victory depended upon his carrying Florida which he initially won by a few hundred votes at the first count. But Jeb Bush (the brother of Bush43) was the governor of Florida and a load of recounts and politics ensued. Once Bush was ahead by a few votes he tried to stop the recounts but his motion was denied by the Florida Supreme court. Finally 5 weeks after election night the United States Supreme court stopped the recounts:-
7-2 on the ground that the recount violated the equal protection clause in the constitution.
5-4 on the ground that no constitutional recount could occur before the electoral college were scheduled to cast theirs.
The US supreme court essentially prevented electoral votes being recounted properly and accurately, by accepting purpose built legal arguments. They handed the election to Bush who was said to have won by 537 votes out of 6 million.
A post election analysis showed that Gore won Florida by tens of thousands of votes.
So the chances of an election night vote count being stopped deliberately for hours on election night in a US presidential election in any state are 0 in 25 elections in any of the 50 states. considering all elections from 1900 to 2016..That is 1250 vote counts in 50 states over 116 years. Every single one of them was free of multi hour vote count pauses directed by election officials and very few if any of them did not finish the vote counting to a point where a winner could be declared on election night.
But since one cannot divide by zero, let us say conservatively that the chances of a state suspending a vote count for hours on election night in a presidential election watched by millions of people live on TV (so from 1948 onwards) are 1 in 19 televised Presidential elections from 1948 to 2020 in 50 states which is 1 in 950.
Here is what happened on election night in 2020
1 There are generally accepted to be 14 swing states or battleground states in the US election
Arizona: 11 electoral votes. The state voted for the Republican presidential nominee in 10 of the last 11 elections.
Colorado: 9 electoral votes. The state voted for the Republican presidential nominee in 7 of the last 11 elections.
Florida: 29 electoral votes. The state voted for the Republican presidential nominee in 7 of the last 11 elections.
Georgia: 16 electoral votes. The state voted for the Republican presidential nominee in 8 of the last 11 elections.
Iowa: 6x electoral votes. The state voted for the Democratic presidential nominee in 6 of the last 11 elections.
Michigan: 16 electoral votes. The state voted for the Democratic presidential nominee in 6 of the last 11 elections.
Minnesota: 10 electoral votes. The state voted for the Democratic presidential nominee in each of the last 11 elections (borderline swing state).
Nevada: 6 electoral votes. The state voted for the Republican presidential nominee in 6 of the last 11 elections.
New Hampshire: 4 electoral votes. The state voted for the Democratic presidential nominee in 6 of the last 11 elections.
North Carolina: 15 electoral votes. The state voted for the Republican presidential nominee in 9 of the last 10 elections.
Ohio: 18 electoral votes. The state voted for the Republican presidential nominee in 6 of the last 11 elections.
Pennsylvania: 20 electoral votes. The state voted for the Democratic presidential nominee in 7 of the last 11 elections.
Virginia: 13 electoral votes. The state voted for the Republican presidential nominee in 8 of the last 11 elections.
Wisconsin: 10 electoral votes. The state voted for the Democratic presidential nominee in 8 of the last 11 elections.
2. 6 swing states stopped counting and failed to declare a result on the 2020 election night.
These were MI WI NV GA PA NC
3. Trump was ahead in all 6 swing states when they stopped counting
4. Biden won 5 of those states after they restarted and then finished counting
What is the probability of that series of events occurring randomly (i.e.
democratically) on the 2020 election night without some kind of overall coordination (i.e. electoral fraud)?
The chances are ZERO that the initial vote count would not be completed on election night in any state.. That is a totally unprecedented outcome in the last 2 centuries of US presidential elections. It just does not happen.
But if we define a recount to be a continuation of the counting process then the chances are
1: 1/950 x 1/950 x1/950 x1/950 x1/950 x 1/950 for the 6 swing states suspending vote counting for hours on election night and then not declaring a result
2: 14/50 x13/49 x 12/48 x/11/47 x 10/46 x 9/45 for all 6 suspending and non declaring states to be one of the 14 swing states in the 50 state union
3: 1/2 x 1/2 x 1/2 x 1/2 x 1/2 x 1/2 for Trump to be ahead when the vote counting stopped in all 6 evenly balanced - 'swing' states
4: 6/64 for Biden to win 5 of of 6 of the swing states. There are 6 possible ways for Biden to lose 1 swing state out of 6. There are 64 possible outcomes.
This multiplies out to
1 in 7.3509 10^17
1 in 5291.6084
1 in 64
1 in 10.6667
So the chances of all those events occurring randomly without coordination are the product of the above which is 1 in 2.6554 x 10^24 or 2,655,400,000,000,000,000,000,000
That is 1 in 2.6554 trillion trillion or 1 in 2.6554 million billion billion or 1 in 2.6544 million million million million
Americans are very good at statistics. But they have Biden as a fake president, because the science of statistics has been banned from presidential election application since 2020. The FBI, we now know, infiltrated enabled and choreographed the vote fraud sit in protest,
in order to be able falsely to paint it as an insurrection. An unarmed American insurrection in which no gun was fired by any vote fraud protestor. An insurrection in which nothing in the capitol building was set on fire.
This iconic image of Richard Barnett with his feet upon Nancy's Pelosi's desk sums up the nature and mission of the protest perfectly
It was a vote fraud sit in protest. This guy is not insurrecting. His weapon is a mobile phone, not a flame thrower and not a firearm.
When the British mounted an insurrection on the white house in 1814, we torched the place. That was an insurrection. We did not carry out a sit in protest. The politicians needed to turn that vote fraud protest into a riot, at the least, in order to cover up the fraud which the voters were protesting. Since then, they have made it clear that they will destroy the academic careers of anyone who tries to use the subject of statistics to prove election fraud as I have above. Hence this article. Steven Sund, the head of Capitol Police, who resigned on Jan7, made 1 request for national guard assistance before Jan6 and made a further 5 more requests during the riot itself. All 6 of his requests were denied. Not only that but Trump himself requested that the National guard be invited before the protest. All these requests were denied by Pelosi, the head of security for the house and McConnell, the head of security for the senate and by Muriel Browser the mayor of DC and by the Pentagon, the head of security for the nation. These are the people who should be being investigated for the security breach and Steven Sund is the expert witness who should be giving the evidence.
I sent an earlier version of the above to every Mathematician in Harvard, Yale, Princeton and the Cambridge University Statistics Laboratory. on 2021February11. Being academics, their email addresses are online for research questions at the links provided.. I asked them all the question: Is there anything wrong with (an earlier version) of the above analysis? One academic from Princeton responded with an argument which helped me to improve the analysis. Another Princeton academic said that he was a theoretical physicist not a political statistician. That was the sum total of their responses. I assume they all still have their academic careers. The writer was a maths scholar at Cambridge University in the 70s.
One can argue that the 2020 election was different due to Covid19, which caused many more votes than normal to be postal votes and that is why there were delays. However postal votes should arrive on or before election day votes, in a non fraudulent election. So they should speed up the count, not delay it. And these delays only occurred in swing states. They did not occur in the 36 non swing states which had the same increase in postal voting. Not even in one of them did they occur.
Of course, that is not the only fraud the President Biden represents. The true president, his boss, did not receive one vote. He is the one that needs impeaching for total election fraud and for a breach of the 22nd amendment - see the Expose article on Obama46 - https://expose-news.com/2022/04/30/obama-is-the-real-president-of-usa/
Incidentally of the 5 people who were killed supposedly due the non insurrection, Ashli Babbit (35) was shot by a Capitol police officer Michael Leroy Byrd (who did apparently give a verbal warning through a closed door but ended up shooting to death an unarmed woman and then of course being fully exonerated). 2 of the vote fraud protestors, Kevin Greeson (55) and Benjamin Phillips (50) were said to have died from heart attacks, which may well have been caused by police stun grenades. One named Roseanne Boyland (34) was crushed underneath a crowd who had chemical sprays fired upon them by the police, who pushed them back through a tunnel and down the stairs leading to it. One police officer, Brian Sicknick (42), died the next day from a pre-existing condition (which resulted in a stroke), which the press falsely claimed resulted from his being assaulted with a fire extinguisher. There was no such assault. In the final analysis, no deaths were caused by any of the vote fraud protestors. All deaths that day were caused by panicked policing resulting from not having enough troopers to deal with the huge crowd. That insufficiency in policing is entirely the fault of Nancy Pelosi and Mitch McConnell and Muriel Browser who denied the extra police that the Steven Sund, the head of the capitol police requested 6x and that President Trump requested once 2 days before the event. For more non mainstream news details of the events on January6 please see
Former Pentagon chief of staff Kash Patel confirmed that Trump authorised 10,000-20,000 National guard troops to protect the Capitol on January4. He cannot as president order them to protect it. All he can do is request that state authorities call them up.
As Patel explains in the new EpochTV documentary, “The Real Story of Jan. 6,” Trump authorized as many as 20,000 Guard troops for use on Jan. 6 during a meeting several days earlier. The offer of troops was rejected by Bowser and House Speaker Nancy Pelosi (D-Calif.), he said.
Of course politifact rates that claim as false.
Here are the videos showing politifact to be politifiction - https://rumble.com/vt9iij-kash-patel-explains-documented-proof-trump-ordered-10000-national-guard-ahe.html
https://www.theepochtimes.com/live-kash-patel-on-jan-6-timeline-trump-authorized-20000-national-guardsmen-two-days-before_4523407.html
There is really only one question that needs to be asked by an investigation into the deaths caused that day: Why were the national guard troops requested by the head of the Capitol Police and by President Trump, 7x in total, denied by Nancy Pelosi and Mitch McConnell and Muriel Browser and the Pentagon?
The answer I would suggest, was to enable sufficient deaths and capitol breaches to paint the narrative that they have now painted. One of the signature plays of corrupted politicians is to investigate their enemies for crimes which they themselves have committed. That is how they prevent a real investigation into the true perpetrators (themselves). That is what the Jan6 committee hearings were all about. They are a text book exercise in counter investigation.
Another classic example is the false accusation that Trump supporters are a threat to 'our democracy'. US democracy has already been hijacked by vote fraud organisation Biden. The present democratic administration is not merely a threat to US democracy. It has 100% ended it. As this article is being written, the actual president of the United States got absolutely no votes at all in 2020.
The January 6 committee is not investigating ANY of the deaths of the 4 Trump supporters that were killed on January 6. It is investigating Trump. That may be why Mar a Lago was raided by the FBI..
So the sacrifices of Ashli Babbitt, Kevin Greeson, Benjamin Phillips and Roseanne Boyland are all the proof we need, to know that the US congress cares nothing about vote fraud or about the deaths of American citizens. They care only about political power. From which it follows that the vaccines are about power politics and not about your health. When you follow politically motivated medical advice your life is as safe as the lives of Ashli Babbit and Kevin Greeson and Benjamin Phillips and Roseanne Boyland were at the capitol vote fraud protest, the democracy loving Martyrs of January6. They gave their lives fighting for fraud free elections. Those who perpetrated the 2020 vote fraud hope that these 4 Great American died for nothing. The writer of this article knows they did not.
To Speaker McCarthy: Build a Statue to the 4 of them and Place it outside the Capitol Building
There should certainly be a statue to the 3 of them who did not enter into the capitol building, but died on the steps outside it. They committed no crime other than exercising their inalienable right to demand fraud free elections. When they died, American democracy died along with them. When the January 6 committee excluded them from its investigation, they showed their inhuman hearts to the entire world. They do not care or want to know how they died. They especially do not care or want to know why they died. But their sacrifice has laid naked the lie that politicians care about your health or indeed about anything at all other than power.
I personally would include Ashli Babbit too. Because the crime of trespass in order to protest the ratification of vote fraud in a presidential election is a justified trespass in my opinion. She was a 15 year air force veteran with high security clearance throughout her entire career. She therefore posed absolutely no risk or threat to any senator or congress person. The only risk she posed was to the fraud that went down that day in the building in which she was protesting.
They were not the 4 Founding Fathers. But they were the 4 MAGA Martyrs. They died fighting for the republic that the founding fathers created. Their crime was to share the same vision as their 4 Fathers.
They took no oath of office to uphold the constitution. But they shamed every senator and every congressman who had. They spoke not with their lips but with their blood.
For whilst the senators were ratifying the greatest electoral fraud in American history carried out by "the most extensive and inclusive VOTER FRAUD organization in the history of American politics" and whilst they were trampling on their oaths of office and defiling American democracy. These 4 were the ones who proved to be true sons and daughters of the founding fathers, true oath keepers of the republic, giving their lives for the right to have their votes counted properly.
Yes. The politicians hiding in the basement of the Capitol building represent the 81 million votes fraudulently counted for Basement Biden. But the 4 MAGA Martyrs who died on its steps and at the door to democracy, represent the 85 million votes that should have been counted for Trump, but never were. How appropriate it is the that the congressmen who certified the 2020 vote fraud of Basement Hiding Biden were themselves hiding in Basement of the Capitol on the day they became his accomplices. The one man hiding his dementia from the electorate, the other group hiding themselves from the electorate they were about to defraud.
The 4 MAGA Martyrs were not the 4 Founding Fathers of the US Constitution. But in their deaths, may they become the 4 Founding Parents of US Electoral Integrity.
In their efforts to hype the performance of their new vaccine against the Omicron variant, Pfizer have revealed that their old vaccine not only did not work against Omicron, it actually went negative in effectiveness within 30 days.
We have been sold an antivaccine as a vaccine. Here is what Pfizer says about their new Omicron shots...
Pfizer and BioNTech’s bivalent vaccine contains 15-µg of mRNA encoding the wild-type spike protein of SARS-CoV-2, which is present in the Original Pfizer-BioNTech COVID-19 Vaccine, and 15-µg of mRNA encoding the spike protein of the Omicron | BA.4/BA.5 subvariants. Because the Omicron BA.4 and BA.5 subvariants contain identical spike protein amino acid sequences, both can be targeted at once with a single mRNA strand. Apart from the addition of the mRNA sequence of the Omicron BA.4/BA.5 spike protein, all other components of the vaccine remain unchanged. - https://www.pfizer.com/news/press-release/press-release-detail/pfizer-and-biontech-granted-fda-emergency-use-authorization
One month after administration, a booster dose of the Omicron-adapted monovalent candidates (30 µg and 60 µg) increased neutralizing (antibody) geometric mean titers (GMT) against Omicron BA.1 13.5 and 19.6-fold above pre-booster dose levels, while a booster dose of the Omicron-adapted bivalent candidates conferred a 9.1 and 10.9-fold increase in neutralizing (antibody) GMTs against Omicron BA.1. Both Omicron-adapted vaccine candidates were well-tolerated in participants who received one or the other Omicron-adapted vaccine - https://www.pfizer.com/news/press-release/press-release-detail/pfizer-and-biontech-announce-omicron-adapted-covid-19 .
We shall now use their findings to prove that the old Pfizer shots destroy your immune system at a rate in excess of 14% per month!
Hitherto we have known that the vaccines cause VAIDS and we saw in October 2021, from PHE figures against delta that doubly vaxxed people were losing their immunity against the Delta variant at 5-7% per week when compared to unvaxxed people. This is how the Expose first revealed that the Covid Vaccines are in fact Trojans. They offer an initial immunity against a variant. But they also progressively destroy your immune system to the point where that initial immunity is wiped out. Then they continue said destruction until the point where your immune system kills most of the vaccinated spike producing cells. Some people die before that point (from cardiovascular disease, from neurodegenerative disease, from spike infected organ failure, from sepsis, from turbo cancers, etc.) as we have seen from the excess mortality figures Others lose a significant percentage of their immune function against viruses in a manner which may not be reversible since the DNA vaccines of Astra Zeneca and J&J.are obviously gene altering and the mRNA vaccines have as many modifications as humans know how to make, in order render what should be temporary RNA almost permanent (N1 Methyl Pseudouridine for Uracil etc.). Furthermore the fake uracil is not identified by the cell as genetic material and so if it gets incorporated into other cell processes, it has the capability to switch off immunity to all sorts of genetic disorders - which could not be more disastrous long term.
The great thing about these new (2022June21) Pfizer results is that when properly analysed, which as not as easy as I first thought, give a percentage destruction of immunity that the old vaccines wreaked in the first 30 days.
Putting these results into tabular form we get
New Vax against Omicron BA4/5 | Old Vax against Wuhan Hu1 | Omicron BA1 Antibody increase |
30ug | 0 | 19.6x |
15ug | 0 | 13.5x |
30ug | 30ug | 10.9x |
15ug | 15ug | 9.1x |
Looking at the table above we see that adding 30 ug of the original Pfizer vaccine against Wuhan Hu1 (that everybody has taken for the 1st and 2nd shots and the boosters up until September 2022), to 30ug of the new Omicron BA4/5 vaccine component, decreases its effectiveness after one month from 19.6x to 10.9x a reduction of 44%. Likewise adding 15ug of the old Wuhan Hu1 vaccine decreases the effectiveness of 15ug of the new Omicron BA4/5 vaccine component from 13.5x to 9.1x, a reduction of 33%.
The causes of these enormous reductions in efficacy are...
1. The old vaccine has no efficacy against Omicron.
2. Both the old and the new vaccine progressively destroy the immune system with spike proteins that they program your cells to make.
3. Adding the old vax diverts some of the B lymphocyte capacity from making Omicron neutralising antibodies into making totally useless antibodies against a computer generated spike protein (Wuhan Hu1) that has never been isolated, was most likely never in circulation and most likely has more to do with Peter Daszak, Tony Fauci and Moderna, than it does with Wuhan.
In order to determine the rate of destruction of the immune system in 30 days we must first remove the reduction in efficacy due to diverting resources away from useful antibody production to useless antibody production. Before we do that there are some key observations to be made about these results.
Pfizer's Phase3 clinical trial of the old vaccine was slated to last for published as a scientific paper in the New England Journal of Medicine. It clinical trial identifier is NCT04368728. It began on 2020April29 and is slated to finish on 2023February15. It is stated to be still active. But the 46,953 participant trial ended after 6 months when they permitted the placebo group to be vaccinated (after having received FDA emergency use authorisation). There will be no further data from that trial, because it would demonstrate VAIDS. They stopped the 34 month 28 months early (after just 6 months) in order to conceal the longer term damage their vaccines do to those who take them.
But the results for the 1,234 participant trial of the new vax have not been published as a scientific paper at all. They are therefore entirely anecdotal. I rang Pfizer on 01304 616161 and asked them when would they be publishing the 60 day and 90 day results from their new Omicron vax trial. The 30 day results were published on June25. So they would have been in a position to publish the 90 day results by August25. I was told there are no further results available. I asked if I could submit a request for the 60 day and 90 day results. Pfizer responded that such a request would most likely be ignored. Yes indeed. Because it would clearly demonstrate the Pfizer mediated destruction of the immune system in precise terms by both the old and the new vaccines.
Pfizer have told us the percentage increase in antibody levels seen in their Phase 2/3 trial of 1,234 patients each of whom had had 3 doses of the original Pfizer vaccine. They have not told us the actual increase in antibody concentration nor the baseline pre trial antibody levels. That is because such results would clearly demonstrate that the old shot did not work against Omicron in the patients who had not actually been infected with that variant. Hundreds of their participants (who had not yet caught Omicron) will have had negligibly small levels of Omicron BA1 antibodies, despite being triply jabbed..
Why did Pfizer omit to publish the omicron BA1 neutralising antibody figures for their old vax by itself? They published them for their new vax by itself. And they published them for the two together. Where are the old vax figures?. In the bin I would suggest because they were NEGATIVE. It produces a decrease, not an increase. Had they published those figures I suspect they would have destroyed the entire basis of the vaccine response to the pandemic. There is a Subpoena waiting to happen. Or better still why do the BMGF or the Welcome Trust not fund such a study if they want to follow the science?
Obviously if your immune system was perfect you would not suffer from any virus or cancer or autoimmune disease or sepsis on Type2 diabetes actually. You would not require most of the products that Big Pharma make.
Conversely, if you had full blown AIDS (be it HIV mediated or be it vaccine mediated) then the only immunity you would ever get would be from Pharmaceuticals. In which case you would require most of the products that Big Pharma make.
So if Big Pharma improve your immune system then they all go bust.
Conversely, if they destroy your immune system then they take over the entire healthcare system.
Which business model do you think they are presently following?
The immune system has a limited capacity to make antibodies. These shots push it close to capacity as can be seen by the 30ug shot only producing 45% more antibodies than the 15ug shot (rather than the expected 100% more were it not near capacity).
Restating Pfizer's results for Omicron BA1 neutralising antibody increases after one month we get
15ug new = 13.5x increase
15ug new + 15ug new = 19.6x increase = 27x 72.6%. This is 72.6% of the expected increase of 2x 13.5x = 27x
15ug new + 15ug old = 9.1x increase
These are terrible results for the old vax. It reduces the vax performance by more than 50%.
One can see that we are running into capacity limits because rather than getting 27x the antibodies from a double 15ug dose of the new vax (2x 13.5x), we get only 19.6x. This tells us that capacity (or immune sufficiency) is limiting the 30ug dose to 72.6% of the theoretical increase.
Therefore we would expect that capacity (not immune sufficiency in this case) would also limit the 30ug dose of new + old vax to 72.6% of 13.5x which is 9.801x. But it does worse than that. It reduces it to 9.1% THERE is the immune degradation part of the equation.
Immune degradation reduces the efficacy of the new+old vax from the expected 9.801x (taking capacity limits into account) to 9.1x, which is a reduction of 7.2%.
So diverted antibody production capacity reduces the performance of the bivalent vax by 27.4%, then immune degradation reduces it by a further 7.2%
But this is only the immune degradation resulting from 15ug of the old vax which is a half dose. So one full dose would lead to a 14.4% immune degradation each month.
Whereas 2 full doses produced a 6.57%
fall off in immunity every week (against Delta in October 2021) which is a fall of 28.15% in 30 days. But thereagain 2 full shots should indeed produce twice the immune degradation of one shot.
So really Pfizer's figures (28.8% per month for 2 shots) do confirm the real world data (28.15% for 2 shots) that we saw from PHE in October 2021, when the Expose first identified Vaccine mediated AIDS..
These results lay bare what the Exposé has been demonstrating from government infection hospitalisation and death figures all over the world (many of whom have now stopped publishing the relevant figures because they were more and more clearly displaying how lethal the vaccines are). The the original Pfizer vaccine not only had no efficacy against Omicron. It also progressively destroyed your immune system at the rate displayed above. It was an anti vaccine against Omicron. It never had any positive effect on Omicron antibody levels. Furthermore, 30 days after your Pfizer booster shot (30 ug of vaccine against Wuhan Hu1) you would have had around 2x7.2% = 14.4% less antibodies against Omicron than you had before you took the booster according to Pfizer's own figures. It was NEVER an immunity booster. It was always an immunity disruptor, an immunity compromiser, an immunity nullifier, an immunity degrader. That is why the infection rates in the vaccinated were so much worse than the infection rates in the unvaccinated for Omicron.
We no longer need government figures to see this. Because Pfizer has gone and done it for us. Their figures clearly show that the original vaccine causes VAIDS at an alarmingly fast rate of more than 14% per month per jab!
They were so keen to show the world how effective their new shots were, that they overlooked the fact that their data also proved how anti effective their old shots were.
I need to state this again clearly because it is so important.
Pfizer's figures for the new vax verses the old vax prove that the old vax did not work against Omicron.
Pfizer's bivalent verses monovalent trial results show that one shot (30ug) of the old vaccine destroys 14% of your Covid19 antibodies in 30 days.
Since one is not considered boosted until 14 days after the shot, it follows that the old boosters were never vaccines, they were always antivaccines, having a negative efficacy by day 14.
Every Pfizer vaccination taken by every human on the planet prior to September 2022, has systematically destroyed their immune response at an initial rate greater than 14% per month.
Every Pfizer vaccinated person has VAIDS.
There is some good news here. Because the rate of immune degradation will decrease as your immune system (your T cells) kill off every vaccinated cell in your body. But if you keep boosting yourself it will not really get that chance and it will be less and less able to kill them off.
I remember when I wrote an article showing from the German government figures out of the Robert Koch institute in Berlin, that vaccinated Germans were 8.1x more likely to be infected with Omicron than unvaccinated Germans and from the Australian government showing that vaccinated people were more than 10x likely to be infected than the unvaxxed. The German government immediately changed their figures and said: Oh we made a mistake. They found another 911 unvaccinated people who had caught Omicron. As if Germans, the best mechanical engineers in the world, routinely make mistakes with numbers. There was no mistake. The Australian figures confirmed it back then. And Pfizer's results above confirm it today.
There are half a million people in the UK with compromised immune systems. Many of them have absolutely zero antibodies to Omicron. Jeremy Vine on BBC Radio 2 actually did a reasonable documentary on them on Thursday September1 from 12:00 - 14:00. These people are condemned to spend the rest of their lives in total isolation having had 5 or 6 Covid vaccinations to no good end. Their immune system can no longer produce ANY antibodies to Omicron. Jeremy interviewed several of them who said that the vaccines are useless for them. The government did not pay for them to discover that they had zero antibodies after 5 or 6 vaccinations. They had to have private testing done, which they paid for themselves, in order to find that out.
The solution for them is a drug called Evushield, which is a monoclonal antibody concoction. It literally gives them the antibodies that their immune system can no longer make. It is the Covid equivalent to antiretrovirals for AIDS. The MHRA authorised the drug in March for immuno compromised people. But you cannot get it on the NHS and you need 2 shots at £800 per shot. Many cannot afford it. So much for the NHS caring about the health of this country. Obviously if you cannot interact with anybody face to face, your earning capacity will be seriously reduced and the taxes you pay every year will likewise be significantly reduced. The idea that such a person is not worth £1600 to the economy over the rest of their lives is absurd. An investment of £1600 would most likely be repaid within a year by the overall improvement to the economy from having another fit and health working person. And that is just the economic argument. The social argument need not even be mentioned. Liz Truss is about to spend 200 Billion on energy apparently. We could fix every immuno compromised person in the land for less than 1 billion. But that would not get any computer generated Wuhan Hu1 spike proteins into them now would it?
These immuno compromised people had weak immunity to begin with and now have absolutely zero immunity in many cases. That is where we will all end up if we continue taking any vaccination containing the genetic code for Covid spike proteins or taking the spike proteins themselves as with Novavax. One woman interviewed on the radio said that she had not had a hug in 2½ years.. Jeremy Vine suggested that the government paid for Covid tested huggers to go and visit people like her. At least that gave her a laugh.
The tragic thing about these immune deficient people is that they are the ones least able to tolerate the immune system destruction mediated by the vaccines and yet they were always the first to be recommended to take the next shot. They are the victims of the most gross medical negligence. They should all be given Evushield for that reason alone.
Pfizer has demonstrated a 44% immune degradation in 30 days at 30ug of the original Pfizer vaccine (the standard vaccine dose). A 30 day clinical trial is not a completed clinical trial. It is a joke. Fauci himself said recently that we don't have time to finish the clinical trials of the bivalent booster - https://www.youtube.com/watch?v=RexHOEpyUN4. They could have made an omicron booster 8 months ago, in which case they would have had time. They could have made a delta booster a year ago. But they plainly have no interest is providing an up to date booster. They just want an excuse to fill us full of the original computer generated spike proteins.
30ug of the new monovalent Pfizer vaccine increased neutralising antibodies by 19.6x after 30 days
15ug + 15ug of the bivalent Pfizer vaccine increased neutralising antibodies by 9.1x after 30 days
So the monovalent vaccine, the fully updated vaccine, was 2.15x better (19.6/9.1) than the bivalent vaccine. It produced actually 115% more antibodies against Omicron than the bivalent vax, because it was fully updated rather than being partially updated. The only disadvantage to the monovalent vaccine is that it does not fill you up with computer generated Wuhan Hu1 spike proteins.
So which one did the FDA authorise? https://www.fda.gov/emergency-preparedness-and-response/coronavirus-disease-2019-covid-19/covid-19-bivalent-vaccine-boosters
The authorised the bivalent one. They did not authorise the monovalent one.
You do not have to be a conspiracy theorist to see that the aim here is not to fix anybody's health. It is still to fill them up with computer generated spike proteins of the old vax.
What is going on here is that the old vaccine, being designed against Wuhan Hu1 (which was never isolated and was computer generated and I doubt was ever in circulation) has zero efficacy against Omicron. All it does is progressively damage your immune system. Whereas the new vaccine, being designed against Omicron, does have good initial efficacy against it as the figures above demonstrate. But all Covid variant spike proteins are antivaccines to the entire immune system and cause Vaccine Mediated AIDS progressively as more and more spike proteins infect your T cells. This is true both of the new and the old vaccines.
We have been sold an antivaccine for Omicron as a vaccine for Omicron and Pfizer's own figures now show it. The reason that the reduction in efficacy after 30 days is 11% higher with the 30ug + 30ug shot than it is with the 15ug + 15ug shot is that the larger the dose, the more spike proteins your body makes and the more damage they do to your immune system in 30 days. If you want to cause no damage to your immune system then do not take any spike proteins or spike protein producing vaccines into your body.
Had Prince Philip not taken the vaccines then I suspect that he would not have died of 'old age' on 2021April9, 6 days after the scheduled date for his 2nd shot (1st shot was 2021January9). Had the Queen not taken them I suspect that she would not have been admitted to hospital (on 2021Cotober21) for the first time in 8 years one month after the calling date to her age group for the 1st booster shot (2021September14) - which she took and which would have done her absolutely no good at all. More importantly she would not have made the mistake of recommending AS A DUTY to her subjects, a man made bioweapon, now proven to destroy the immune system, to increase Covid infection hospitalisation and death, and now being the prime candidate for causing an unprecedented increase in excess mortality in her subjects who live in heavily vaccinated commonwealth countries. Her Royal Highness apparently also died of 'old age' according to the death certificate written by the doctor who administered the gene hacking vaccines to her.
On that subject there is a great new study from Harvard, John's Hopkins, Oxford, Edinburgh, California and other Universities showing that for every 1 person whom the vaccines saved from hospitalisation (according to government figures), 18-98 people suffered serious life altering adverse reactions. It is an amazing world wherein such prestigious universities are 6 months behind writers for the Exposé.
There was a fascinating comment by a switched on woman in the Telegraph (more switched on even than the Queen). She asked: Is this whole Covid thing some kind of intelligence test?
A brainwashing test from the globalist demons and a wisdom test from the nationalist God of freedom, who forced us into nations at Babel in order to prevent a global political monopoly such as the WEF, and global healthcare monopoly such as the BMGF would be my answer. Choose well Glasshopper!
Pfizer's results clearly show that the old vaccine does not work at all against Omicron. Why, therefore, has its authorisation not been withdrawn?
The new vaccine is authorised on the basis that it is a minor modification to the old vaccine which has already been authorised. All Pfizer had to do was demonstrate efficacy for the new product. but they failed to do that. They produced some anecdotal evidence which has never been published as a scientific paper. Furthermore their incomplete evidence only covered 30 days of results in circumstances where vaccine related side effects are known to occur for a period much longer than that. Furthermore their result invalidated the authorisation for the original vaccine which was never tested against Omicron. Well it now has been so tested, anecdotally. And it failed that test.
Regulators cannot have this both ways. Since they have accepted the anecdotal evidence that the new shots are efficacious against Omicron. They have no choice but also to accept that the same evidence shows that the old shots are anti efficacious against Omicron and therefore should be withdrawn immediately. They should be banned in fact and not just for under 50 year olds. Why is it that only Denmark that realises there is something rotten in these shots?. Once they are banned then the new shots would need full clinical trials published in scientific journals, not corporate press releases, to qualify for an authorisation.
The FDA and the MHRA have authorised an updated vaccine with no clinical evidence of safety or efficacy on the back of an authorisation for the original vaccine which has now been shown by Pfizer itself, to have no efficacy against Omicron and which the Oxford, Harvard, John's Hopkin's, Edinburgh and other universities scientific study shows gives 18-98 life altering side effects for every 1 person it keeps out of hospital.
These regulators control our entire healthcare systems. They are corrupt. Our health services are finished until they are closed down.
Every reader of the Expose knows that politicians lie. Every scientist ought to know that science is the selfless discovery, postulation, pursuit and demonstration of scientific truth and furthermore is the absolute refutation of scientific falsehood.
So I ask the reader. If your salary as a scientist is paid by a liar, will you do what the liar pays you to do or will you remain a true scientist? The answer has already been provided by the chief mathematical modeller of SAGE, a Professor Graham Medley. He famously said to Fraser Nelson of the Spectator...
This produced my favourite quote from Fraser: Government stats departments indulge not in evidence based policy making but in policy based evidence making.
So just as the Main stream media founded 'fact checkers' to add credibility to their miserable lies
So the politicians make committees of large numbers of eminent scientists to add credibility to their miserable lies.
And the scientists such as Professor Graham Medley freely admit that they are following the politics, not the science.
So let me state this clearly. No scientist on a government payroll, is speaking as a scientist anymore. They have all become just another brand of politician. They are just more credible liars than the politicians are themselves.
And the fact checkers are just more credible liars than the main stream journalists and more particularly main stream news editors are themselves. It is all the same con trick. If you do not believe my lie, then get someone with more credibility than I, to lie as well. Or better still get a whole committee of eminent people, get hundreds of them, to repeat the lie. Of course there are exceptions. But these are drowned out or indeed written out of the minutes according to Rishi Sunak.
What we need to see is some of these government scientists recovering their scientific integrity by becoming whistleblowers. I ask every one of them on SAGE, the JCVI etc etc. Do you really think that your status and your financial and political advancement is more important than the health and the lives of the people who take your corrupted advice? If so then I am afraid you do not understand Newton's 3rd law.
Every person who dies of a vaccine related condition who relied upon advice that you signed off on, even if you voted against it but did not resign or whistleblow, has human blood just like you have. And what makes you think their blood will not be asked back from you? Do you think Newton's 3rd law only applies to inanimate bodies? Do you? Whatever a man is sowing, this he will also reap says the architect of the laws which Newton discovered and which you may disregard but from which you cannot escape.
I fear that it will be a rather short age. Not exactly an aeon. More like a Kodak moment, unless we get this right..
Vlad the blackmailer, has revealed his true colours to the world to a cacophony of nonchalance. Here are the results of his 4 'referenda'
Those in favour of giving up their sovereignty this week to a self confessed nuclear imperialist in the process of conquering the rest of their country were: 87.05% in Kherson, 93.11% in Zaporizhzhia, 98.42% in the Lugansk and 99.23% in the Donetsk
I have never in my life seen a political poll with more than an 80:20 split. I once conducted a London wide poll on should St Bartholomew's Hospital (the oldest hospital in London) be closed down and sold to a property developer. The result was 99.25% No and 0.75% Yes. That admittedly is a greater majority even than the Donetsk result. Frank Dobson, the then secretary for health, saved Barts as a result of the poll, the votes for which were hand delivered to his office in Whitehall. Saving the oldest hospital in the world (at the request of the Save Barts Patients Campaign) got me one paragraph in one of the 4 issues of the Evening Standard.
The Russian position is that they can only use nuclear weapons in defence of their own land. So by voting to become a part of Russia, you enable Nukin Putin to nuke your relatives in other parts of Ukraine if they attempt to liberate you from his annexation, which they are presently giving their lives to achieve. I mean who wouldn't want a nuclear bomb going off next door to them which kills some of their relatives? So really you pretty much guarantee a nuclear strike on your doorstep, because Putin has been at pains to point out that he is not bluffing, and Zelenski has made it clear that he intends to continue fighting for liberate all of Ukraine. .
So really the referendum was: Would you like your relatives in the neighbouring oblasts to yourself to be nuked YES or NO? Maybe that is why them call the Oblasts?
So it is clear that these results are a meaningless fiction. There is no democratic basis for Russia to annex these regions just because at this point in the military proceedings she happens to be in control of them. Furthermore even if all the results were genuine and legitimate, they would have zero legal or democratic effect because the rest of the country has not agreed that the referenda should be held or that the results are legitimate. Even furthermore no referendum has been held of Russians to see if they want to annex those parts of Ukraine and risk getting into a nuclear war themselves. Putin would not win such a referendum because the Russians do love their children too.
The sovereignty of a democracy rests with the people not with one separatist or should I say Wagner group insurrected province and not with one national leader
These referenda without the approval of the rest of Ukraine are an insult to Ukrainian national democracy and to Ukrainian national sovereignty AND to Russian national democracy and to Russian national sovereignty. That is what Putin has now shown us, he is all about.
Since Putin has no regard for either democracy or sovereignty, his own election results must be viewed through the same lens as his Ukrainian masterpiece. Indeed as I have stated before in the Exposé. I cannot forget that according to Max Blumenthal and Jimmy Dore (14:15 into the video), Yeltsin got the OK from Clinton before he rigged Putin's first presidential election against Nemtsov whom Putin most likely had assassinated in 2015 outside the Kremlin. He was shot in the back by a Chechen Assassin whilst having dinner with his Ukrainian girlfriend. The world would have been a very different place had Clinton chosen Nemtsov. Clinton is a globalist of course. Yes. Rather than the Russians interfering in American elections as charged by Democrats, the Democrats directed the determinative electoral interference that gave Russia to Putin these last 22 years.
So there are several things that need to be said here and you will not find them or their likes uttered on infowars.
1. According to the times of Israel, Putin said on 2022October1
“I want to say this to the Kyiv regime and its masters in the West: People living in the Lugansk, Donetsk, Kherson and Zaporizhzhia (regions) are becoming our citizens FOREVER”
This again shows a total disregard for democracy. It they genuinely voted today to join Russia (which they most certainly did not), then they must be free to vote tomorrow to leave it. Because democracy gives the people the power of self determination not their leaders and not their conquerors. But Putin has turned that one rigged vote into a life sentence. That is not democracy it is autocracy..
2. In 1994, the UK, the US and Russia persuaded Ukraine to give up its nuclear weapons (it had the 3rd largest nuclear arsenal in the world at the time - more weapons than the UK had) in return for security guarantees from each of the 3 countries as declared in the Budapest Memorandum, the first two paragraphs of which agreement state.
1. The Russian Federation, the United Kingdom of Great Britain and Northern Ireland and the United States of America reaffirm their commitment to Ukraine, in accordance with the principles of the Final Act of the Conference on Security and Cooperation in Europe, to respect the independence and sovereignty and the existing borders of Ukraine.
2. The Russian Federation, the United Kingdom of Great Britain and Northern Ireland and the United States of America reaffirm their obligation to refrain from the threat or use of force against the territorial integrity or political independence of Ukraine, and that none of their weapons will ever be used against Ukraine except in self-defence or otherwise in accordance with the Charter of the United Nations.
The purpose of the 1994 memorandum was to avoid a nuclear war involving Ukrainian nukes. Putin, not satisfied in breaking his word in every respect of that agreement is now breaking the spirit of the agreement by introducing Russian nukes instead of the Ukrainian nukes which the memo succeeded in eliminating.
So what Russia under Putin has done is to con Ukraine into giving up its nukes, with a meaningless security guarantee, and then illegally invade her for the purpose of annexing Crimea and fomenting a civil war in the Donbas to prevent NATO membership and then use the civil war which it fomented as a pretext for a full invasion, wherein any conquered land is annexed with a sham referendum and then defended with nuclear weapon threats.
A world which permits such behaviour without challenge is doomed. And it is doomed in very short order.
Sure the West and Russia were both interfering in Ukraine at the time of the Euromaidan revolution that removed Yanukovich in 2013-2014. But the Orange Revolution in 2004-2005 had removed his rigged election result 10 years earlier and gave us Yulia Tymoshenko. Yanukovich should never have been permitted to run the country from 2010 having been found by the Ukrainian Supreme Court to have rigged an election 6 years previously in 2004. The history of Ukraine is just election fraud followed by coup followed by election fraud followed by coup. They ended up with the comedian Zelenski, who was actually elected by a landslide without a coup in 2019. I think you have to be a comedian to deal with the politics of Ukraine. I would suggest that Zelenski has a far more credible electoral mandate than Putin has and certainly a better sense of humour. No man should run a huge nation like Russia, which is twice the size of the US, for 22 years. 2 terms are enough for both Putin and for Obama (who is now on his 3rd term as OBiden).
Given the above, there can be no question that Putin is not democratic at all but is rather a self confessed eternal nuclear imperialist in a world which decries even the temporary non nuclear imperialism of the British Empire as an anachronistic aberration.
How can we be pulling down statues to dead imperialists and slave owners whilst leaving Putin, a living imperialist and enslaver of Ukrainians, in place? I do not believe in the death penalty. But I do believe in lawfulness. I for one call for Putin to be removed from office for electoral fraud, for war crimes and for the murder and torture and false incarceration of many of his opponents and for being a self confessed nuclear terrorist and a self confessed nuclear imperialist and for the obvious electoral fraud of his sham referenda, in which he rigged the result to make the overwhelming majority of the citizens of the 4 annexed territories look like nuclear assassins of their own friends and relatives For if I did not, I would be trampling on every law that gives mankind a chance to survive the Age of nuclear imperialism
3. Here are some basic war crimes
A. The invasion of a sovereign nation other than in legitimate reactive national self defence is a war crime. Ukraine had demonstrated no designs on conquering Russia or annexing it prior to the present conflict, despite the Russian funded separatist conflict in the Donbas
B. Flattening a city with carpet bombing and then sending in the troops into a pile of rubble is a war crime.
C. Kidnapping non combatant civilians and forcibly relocating them to a foreign land is a war crime not dissimilar to slavery. In fact military conquest was the origin of involuntary slavery.
D. Destroying health critical infrastructure such as power stations and hospitals is a war crime.
E. Making nuclear power stations into military targets should be a war crime.
F. Threatening non combative nations with nuclear strikes should be a war crime.
Mankind has no future unless we embrace and enforce laws which give us a future, without removing our free will. Nuclear imperialism is the shortest route mankind has to self destruction. So Putin and his cabal need to be removed as a top priority and not with a drone strike. He needs to be brought to justice and incarcerated lawfully, not lawlessly, as do his enablers. Where is the warrant for his arrest? WHY has it not been issued? Where is the legal mechanism to deal with this new menace?
In the UK arrest warrants are issued for expressing opinions deemed offensive by politically motivated activists on twitter. This guy has ruined the lives of 40 million Ukrainians not with questionably offensive re-tweets, but by killing their friends, colleagues and relatives. But unsatisfied with that misery and suffering he has now ruined the lives of a further 150 million Russians by conscripting their young men to go and fight in a war with inadequate training and inadequate equipment and corrupt leadership, for the purpose of denying their Ukrainian brothers the right to be what every nation in the world is: A sovereign state.. Yet no arrest warrant?
The UK should issue one for him and for his enablers now. But therein lies the problem.
Putin is KGB/FSB. He was a WEF young global leader, an Alumni of Klaus Schwab. That was the Putin who transformed the Russian economy with Putinomics. The Putin who invaded and conquered Crimea without one loss of life. The Putin who put on the cowboy boots to meet with Bush43. The Putin who pulled Russia out of the ashes of communist corruption, restored his nations pride in themselves and gave Russians the power to emigrate all over the world contributing enormously to the nations in which they settled with their famed intellectual coolness and analytical practicality. Putin was the guy who empowered Russians to reach their potential and who outplayed the West both politically and economically. This was the Putin who was interviewed by Megyn Kelly on March1 2018. I recommend the interview. That Putin was full of fun, at the top of his game, and showed no paranoia at all.
That brilliant political chess player is nothing like the brute presently running Russia, who has the finesse of a Nazi Jackboot and the heart of a Nazi incineration chamber assistant. How has the angel of Crimea turned into the demon of Donbas? How can the same general who executed a near perfect annexation of Crimea screw up so badly with his botched annexation of the Donbas that he has to resort to sham elections, nuclear threats and mass conscription?
1. Former Secretary of State Condoleeza Rice says Russian President Vladimir Putin has always been calculating, but he appears to be “descending into something I haven’t personally seen before.”
“He was always calculating and cold. But this is different. He seems erratic,” Ms. Rice told “Fox News Sunday.” “There is an ever-deepening, delusional rendering of history. It was always a kind of victimology about what had happened to them [Russians], but now it goes back to blaming Lenin for the foundation of Kyiv.”
2. Former President Barack Obama said Vladimir Putin appears to have changed, and when he was in the White House, he didn't believe the Russian president would risk everything to launch an invasion of Ukraine.
"I don't know that the person is the same as the person who is now leading this charge," he said. However, "he was always ruthless," Obama said of Putin Wednesday, during an event hosted by the University of Chicago's Institute of Politics and The Atlantic.
3. Senator Rubio asserted that “Putin’s not the same guy he was five years ago” and “would rather have World War III than be humiliated” by the West.” He added that Putin, now willing to take more risks, “poses real dangers.”
4. The Archbishop of the Ukrainian Orthodox Church (a branch of the Russian Orthodox church that split from Moscow in 1992), Patriarch Filaret compared Putin to Cain who killed his brother Abel, saying....
"With great regret I must now say publicly that among the rulers of this world ... there has appeared a new Cain, not by his name but by his deeds,"
"Like the first fratricide of history, Cain, these deeds show that the afore-mentioned ruler has fallen under the action of Satan,"
"He calls himself a brother to the Ukrainian people, but in fact according to his deeds, he has really become the new Cain, shedding the brotherly blood and entangling the whole world with lies,"
He said that Putin “himself tells obvious outward lies: while organising and sending mercenary killers to our countries, he talks about an ‘internal conflict' in which he is allegedly not involved.”
About 15 percent of Ukrainians are believed to be members of the Ukrainian Orthodox Church.
Before we can understand who his enablers are we have to understand who Putin himself is. The concept of demon possession is well known today from horror movies and of course from Jesus' ministry during which he expelled many different types of demon. It is not an alien concept to us. And neither are demons aliens. They were not born human. They were born as angels. But they have again become humans. Just as we shall become angels. For they are our older brothers and our older sisters actually. They were born upon the rooftops of the palaces of heaven (for the most part). Whereas we were born in the gutters of the slums of the earth. Gutters befouled by them. But the more irritated the oyster, the greater the pearl it produces. So not only are we all finding out for ourselves, for the first time, what the demons are really like, right now. But they too are finding out for themselves, for the second time, what it is to be human. For just as at the start of Christianity they were thrown down to the earth during Jesus' ministry. So at the end of Christianity in this world, they are thrown down again.
Their objective is simple. It is to be our God. The trouble is that they all want to be our God, every single one of them. So they are continually in power struggles for supremacy. They delight and perhaps even prefer to become our God by deception. Because then they can prove to themselves how much more intelligent than us they are. There are three ways in which they can become our God. They can make us into their progeny by altering our genes (hence the vaccines - specifically the computer generated Wuhan Hu1 spike protein - present in every single authorised vaccine. None of them contain envelope proteins. None of them contain nucleocapsid proteins and none of them contain membrane proteins). Or they can enforce their morality (wokeness) upon us without us realising that we have joined their church Or they can conscript us into a war and entice us to commit war crimes or defile our conscience in such a way as to become Cainian by covenant and lose our Abrahamic covenant salvation status. All 3 are brilliant deceptions.
They have various legal mechanisms by which they gain control over your life of which you are unaware (which they think is too cool). There is the Cainian covenant (to be a citizen in Hell), the Viper covenant (to be a priest to those going to hell) and the Serpent covenant (to host a demon - male or female). These are mirrors of the first Abrahamic covenant (to be a citizen of the Kingdom of God on earth), the Isaaic covenant (to be a priest in the Kingdom of God on earth) and the Jacobian covenant (to be a saint, that is a King or a Lord in the Kingdom of God either in heaven through the first new covenant or on earth through the second new covenant). So his enablers are the descended demons and they want us all at each other's throats. They are the real globalists, the ones who enticed Nimrod to build the original tower of Babel, which their successors, the globalists of today, are right now reconstructing with surveillance and financial and mass media technology..
The Kingdom of God is the next administration of mankind on this earth. It is the result of a heavenly general election which they have already lost if you like. It is not a bunch of fairies sitting on some clouds playing harps. It is the opportunity for all of us to get right in the next administration of mankind under Jesus, everything that we got wrong in the present administration of mankind right now under the demons directly.
It is second chance city for all that want it because they can see the injustice in this present system and want to do something about it. The demons are down here to be revealed to us in the apocalypse of Revelation. For the last lesson we get from the tree of the knowledge of good and bad comes directly from our abusers just as the first lesson did in the garden of Eden to Eve and then to Adam. Only this time we have enough experience to pass the test that Adam and Eve initially failed..
They wish to deny us that second chance because they do not value or understand love, forgiveness, mercy, family loyalty, lawfulness or morality. They only value power control status, self glorification and self gratification. To be fair to the demons, which is more than they have been to us thus far, their vehicle (the angelic body) is not as good a tutor for empathy as is ours. When we see a girl with a toothache we feel her pain and want to end it. They do not. Angels don't get toothaches. All the things about being human that cause us pain are actually the reason why we learn morality more quickly than do the demons.
Perhaps Mortality is the best tutor for Morality?
Our hearts are softer than theirs. We are the clay and they are the iron in the terms of Daniel2. But we are all sons and daughters of the same God and they can repent just as we can descend to their levels of depravity. That is the beauty of free will.
So they are more sexually depraved, more violently depraved, more self indulgent, more self conscious, more vain, less empathetic, more deceptive, more power hungry and most of all more worship hungry than any human we will have ever known in our few years of human life. I cannot write with much expertise on this subject because we are yet to see the full bloom of their heartlessness. But that is why we are here and that is why they are here and that is why all of heaven will be watching the both of us. This is one part of what the apocalypse is about to show us. It will show us where heartlessness leads. It leads to the grave of course. But worry not. God has mastery over that state and Jesus will end it when the apocalypse is completed.
But in the meantime we have to be prepared for an inhuman level of dishonesty, hard heartedness and self indulgence.
If defunding the police has taught us anything, it has taught us that security requires law enforcement. That lesson is just as valid for international security as it is for intrametropolitan security. Margaret Thatcher was not a good economist. She was a worse healthcare reformer, the worst this country has ever seen. But she was the best foreign policy and conflict resolution operative of her generation. She wanted to lock Saddam up after Gulf War1. That would have avoided Gulf War2. But Bush41 would not listen to her. So Bush43 and Tony Blair went and killed half a million Iraqis as a result. Here then is the lesson that she understood and precious few of her contemporaries along with her. Wartime aggressors must be made to pay for the damage they inevitably do. And those responsible must be prosecuted criminally. Otherwise every national criminal justice system is a joke. And wars will never end.
A solution which enshrines injustice often leads to another war. This was true for the treaty of Versailles. It was true for the invasion of Crimea. It may yet be true for the invasion of Eastern Europe by Russia during WW2. That was resolved peacefully by Gorbachov. But Putin may yet undo all his good work of liberating conquered nations. Putin and future Putin's need to be Putout of power and Putin to prison. Because if not we will never see an end to them. There is no long term solution to the Ukrainian conflict which does not result in Russia paying for the damage it has done to Ukraine and Putin being removed from office. How you get to that solution with a nuclear power is a whole new ballgame. We should as a race have enacted international laws which make war pointless before we reached the nuclear imperialism stage. But every building in Ukraine that Putin has knocked down, Russia should pay to rebuild, where it stood under a Ukrainian flag. Because the law requires it and nuclear powers cannot afford to be lawless anymore. How you pay for the hundreds of thousands of dead and displaced and kidnapped civilians I do not know.
Russian soldiers and conscripts are just as much victims of the new Putin as the Ukrainians are themselves. They are dying in similar numbers and for absolutely nothing other than the destruction of the lives and loves of both nations. Russia is too big even without Ukraine. It is twice the size of the US. The last thing it needs is more land.
Satan is always boxing mankind into a corner and offering him what looks like the one and only way out, which just happens to be precisely what Satan wants from us. In this case it will look like WW3 is the only way to bring Putin to book. But that is incorrect. The better solution is to put Russia in prison until they pull out of Ukraine. Buy none of their goods or services. Sell no goods or services to them. Cut off their phones and internet and banking. Invalidate every Russian passport (but not the non Russian passports of Russians with dual nationality and not the passports of conscription refugees whom we must take in for the duration of the conflict). Do to the whole country what one would normally do to any other criminal. For that is all they are under Putin. Just one very very big criminal.
But there is another more innovative proposal. Offer Russia membership of NATO if they pull out of Ukraine completely. To achieve worldwide peace, every country in the world should agree to protect every other country in the world from territorial aggression. Let's start with Russia. Then let's expand NATO to include to all 5 permanent members of the UN security council (i.e. expand it to include China as well). Let those nations truly guarantee the security of the world not by sitting on a committee in New York. But by committing their armed forces to the proportionate (preferably non nuclear) defence of the sovereignty and territorial integrity of every nation on the planet INCLUDING RUSSIA and INCLUDING CHINA.
We are not going to achieve worldwide peace by throwing Russia off the UN Security Council. But if all 5 Permanent members join NATO we just might.
One Caveat. NATO forces should never be used for internal policing of any NATO member. They should only be used to counter external aggression.
Let me introduce the reader to a concept that would get him thrown out of any church he presently attends. Even the demons can and do repent. For Satan himself will expel Satan says Jesus using the accusation levelled against him by the Pharisees. Satan1 will throw out Satan2, his successor, after Satan1 has repented. So there is always hope.
The purpose of WW3 to the demons is to have an excuse to conscript everybody and declare martial law worldwide and take total control of all of our lives. The demon running Putin does not want only to conscript 300,000 Russians. He wishes to conscript everybody he can period. He wishes to have conscription as a punishment for non conformers to his regime. And finally he and his opponents and his allies will send to the front line anyone who refuses to be vaccinated we interpret. That being the fulfilment of Daniel3. If you are not prepared to bow down to the image, to worship the new digital currency, which you cannot buy or sell without the Mark of the Beast, which will be a social credit score linked digital ID, given ONLY to the vaccinated, then you will be thrown into the fiery furnace of WW3. BUT just as none of the 3 Hebrew boys were harmed by that furnace in Daniel3. Nobody conscripted into WW3, for refusing the Mark of the Beast, will be damaged by that war. Presumably partly because they refuse to kill their brother.
For millennia mankind has been outplayed and outmanoeuvred by the demons, mainly because they had a heavenly view of this planet (the high mountain from which Satan showed Jesus all the kingdoms of the world in an instant of time) that gave them massively superior intelligence to what we had. But they no longer have that view. Their heavenly authority has now ended (if our new chronology is right). And Jesus is about to be installed as our Caesar. That is another reason for WW3. For the demons would rather wipe us all out than hand us over to Jesus.
So for the first time in history, mankind has a chance to outplay the demons, to outmanoeuvre them. The way to do that politically is to stop WW3, before it starts by NON military means such as proposed above. They way to do it individually is to hold on to the love you have for all your brothers and sisters and to recognise that each one of them will one day be a God as you too will be and to have faith that however bad things look, Jesus has this. Every Ukrainian has a right to defend his home and his nation against a regime that is presently conquering them and enslaving them and torturing them and killing them. And everyone else has a right to help them in any way they choose. For no man has a greater love than this, that he should lay down his life for his friends.
No man and no nation has a right to conquer or enslave his brother against his will. That is a lesson that the British, the French, the Spanish and all the empire builders of the last millennium have learned including Russia under Gorbachov and including the old Putin who was very friendly to the West in his first term and remained so until he was abused by the US under Bush43, who thought they could unilaterally build a nuclear shield and therefore refused to end the nuclear arms race. That decision was a disaster for the security of mankind. It weaponised the old Putin to the point where he became eligible for demon possession, I suspect, although his murder, incarceration and torture of opponents and whistleblowers such as Magnitsky may have also been the trigger for that indignity.
But this new Putin is a different beast. His obsession with history may arise from the fact that he saw it all as a demon and caused some of it himself I would imagine. He may be trying to settle some kind of demonic grudge he has against the demon kings of the West. He and all the other globalist demons are a one way ticket to oblivion and the sooner we stop their train the less painful that process will be. The trouble is that any nation which possesses nuclear bombs is just another carriage on that train. I mean no human is safe whilst nuclear bombs exist in a world run by demonically possessed people. That is obvious. And even if you do not believe in demon possession, some among mankind are not so far behind them in heartlessness, megalomania, control freakery, self glorification and self gratification.
Nuclear Imperialism was always going to happen. Our challenge today is to defuse it before the demons make us all an offer that we cannot refuse. That offer being: Serve us or we start throwing nukes around. The precise offer that Putin has made to 4 parts of Ukraine in fact. The simple evidence I can adduce for demon possession is the woke religion, which is the precise opposite of Christianity and is therefore the religion of the antichrists, who are the demons, the ones whom Michael threw out of heaven to the earth in Revelation12. Here is my concise new table showing what wokeness truly is.
Doctrine | Biblical Christianity | Woke Morality |
OFFENCE | Turn the other cheek | Take offence and do not accept apologies |
FAMILY | Model for all morality | Obsolete Paradigm to be dismantled |
LOVE: | Love thine enemies | Hate cancel and deplatform your enemies |
NATIONALISM: |
Nation states were designed at Babel to prevent a global political monopoly |
What we need is a global political monopoly |
SEXUALITY | Be Heterosexual | Be Alphabet with no H. Destroy Heteronormalcy - move ever closer to legitimising and normalising Paedophilia. |
GENDER: | Binary: 2 Biological genders. Every cell in the body declaring one or the other through Chromosomes | Non Binary. Deny Biology. Invent bogus genders with no basis in biology.. |
FORGIVENESS | Forgive trespassers who repent | Do not forgive trespassers even when they publicly repent |
JUSTICE | Eye for eye tooth for tooth. Do not be partial in judgment. Hear the little one the same as the great one. | Tweet for Job. Persecute the non woke exonerate the woke. |
MEN & WOMEN | The Man is the head. The woman is designed to help the man exercise power more justly & lovingly | Masculinity is toxic. Women therefore make better heads. |
CROSS DRESSING | A woman shall not wear a man's garment, nor shall a man put on a woman's cloak, for whoever does these things is an abomination to the Lord your God. | Drag Queens for kids. Pride parades for Drag Queens. Men can identify as women and women can identify as men. |
CHILDREN AND SEX | Parents determine age of sexualisation & age of consent. No procreative sex outside of a marriage agreement | State forces sexualisation & non binary grooming onto minors. It preaches & facilitates gender mutilation of pre-pubescents under the risibly false pretext that they know what sex their body should be before their body is capable of having sex |
IDENTITY | Personal, Family, Gender, Tribal, Ancestral, Community, National, Religious identities are really important. Every Old Testament Jew knew precisely where he came from.. | You can identify as whatever you like. You do not need a family. You do not need a country. You do not need a faith based religion. You just need to do like you are told by your Woke Meisters (Demon possession is the ultimate identity fraud). |
THEFT | Thou shalt not steal. | Theft is not to be policed because everyone will soon own nothing and be happy. We do not wish to empower people with ownership of anything. |
PHARMACEUTICALS | No kingdom inheritance for those who indulge in Pharmacology (farmakeia) | No job or holiday for those who fail to take government recommended pharmaceuticals |
CHARITY | True worship is looking after widows and orphans personally. | Create 20 million widows and orphans by failing to manage HIV and manufacturing unjust wars. Leave charity to the state. |
VEGETARIANISM | After the flood God gave mankind neat to eat. | Save the planet - eat bugs and veggies only. Whereas in truth pastures regenerate and store more CO2 when fertilised by herd animal dung |
HISTORY | Do not deny it. Do not revise it. Accurately record it (as did the bible) and learn from it. Treasure mankind's history. It is all a lesson from God. It is our eating from the tree of good and bad. | Mankind's history is a catalogue of abuse by people who were not woke enough. All your heroes were villains. Any statue to any human is to be defiled and torn down. You will revere and worship nobody and nothing except wokeness. |
ABORTION | No abortion after the foetus becomes a human soul (around 19 weeks when the central nervous system is completed and the two halves of the brain are connected) | Women should have the right to kill their children at any time up to birth (NY, CA, VT, RI NM). Even though it is known that after 22 weeks they are viable if born. Albert Einstein was 2 months premature = 29½ weeks. Sir Isaac Newton was born weighing 3 lbs = 29 weeks. Sir Winston Churchill was 2 months premature = 29½ weeks |
RACISM | God is not partial. But in every nation the man that fears him and works righteousness is acceptable to him | CRT is just racial communism where all success or failure is falsely ascribed to privilege or prejudice in others rather than effort or indolence, natural talent or ineptitude on the part of oneself. It falsely classifies 'whites' as a race and 'blacks' (by which is generally meant Afro-Carribeans) as a race. Blames 'whites' for the excessive criminality of 'blacks' which is not seen in Asians. It is of course intrinsically antisemitic, because the Jewish race is generally white. CRT is overtly antisemitic, overtly racist and ideologically marxist. What a great combo! |
SLAVERY | Abraham owned 318 slaves in Genesis 14:14. The early Christians described themselves as slaves of God. God is not against slavery. He advocated it in the law of Moses, Slavery was used as a form of privatised prison with a maximum sentence of 6 years of Deuteronomy 15 and as the original form of privatised social services. | Men and women should not be slaves to each other. They should be slaves to the state. |
FINANCIAL FREEDOM | 25 And Judah and Israel continued to dwell in security, everyone under his own vine and under his own fig tree, from Dan to Beer-sheba, all the days of Solomon. (1 Kings 4 NWT) 21 And they will certainly build houses and have occupancy; and they will certainly plant vineyards and eat [their] fruitage. (Isaiah 65 NWT) |
In woke globalist ideology we will all own absolutely nothing and then supposedly be happy. But that is quite obviously a lie. If we own nothing we will be miserable and unhappy until justice and fairness are restored and the Bishops of wokeness return to the people what they have stolen from every one of us. If we work and receive no fruits of our labour then we are slaves with no release. That is an injustice and injustice always leads to pain suffering and misery. |
Let me make this one thing plain. I am not asking anyone to accept that the left column of the table is the route to moral sustainability or that the right column is the route to self annihilation (although I personally believe both to be true). Because no 2 men and no 2 women agree on what sustainable morality should be. All I am asking is that the reader sees that wokeness and Judeo-Christianity are polar opposites. Neither am I bible bashing. I am making the point that wokeness is just another religious cult. And actually it is the wokers who are the true bible bashers. They are evangelising young people into their cult at a faster rate than the Christians are at present.
The world has become a church run by the Antichrist.
Being a nuclear power is the same thing as putting a suicide vest upon every citizen of that power. Combine that with demon possession and you have Armageddon. The only people who can be trusted to wield nuclear weapons are those who would refuse to use them. So destroy them before the demons (who cannot be trusted with them) use them to destroy us.
The writer has just realised that in early 2018. when DARPA outwardly rejected Peter Daszak's application for $14,209,245 for his project DEFUSE to engineer a human lung airway lining cell specific furin cleavage site at the S1/S2 junction (the junction of the 2 parts of the spike protein) where no other SARS related coronavirus has ever had such a site, the US deep state (US intelligence) actually accepted the project and classified it, having instructed DARPA to reject it as a cover story.
We know that to be true because in late 2019 SARS- CoV-2 and Covid19 appeared with a humanized furin cleavage site in precisely the position that Daszak had proposed and furthermore it took the humanized codon form of CCT CGG CGG GCA CGT coding for the 5 amino acids PRRAR, in a humanised furin cleavage site. Which form is unknown in any virus at all. But it is known in cows and humans and many bacteria. Since cows, bacteria and humans cannot infect viruses, nature cannot have put it there. The only way for that coding to get into a virus is by a human being gene splicing it into the viral genome. Prof Luc Montagnier first realised this in 2020 by considering the HIV components in the SARS-CoV-2 spike protein.
So we know that a human called Peter Daszak proposed the insertion in early 2018. We know that only a human could have inserted it. And we know that said insertion occurred in late 2019. And we know that said insertion was the only difference longer than one Codon (3 bases) between SARS-CoV-2 (causing Covid-19) and the bat coronavirus RaTG13. And we know that the insertion occurred at the place that Daszak had proposed to insert it. And we know that the insertion was a humanised furin cleavage site as Daszak had proposed. In other words SARS-CoV-2 was the fulfilment of the 75 page project DEFUSE proposal.
If DARPA had accepted the proposal, we would all know that Peter Daszak made Covid-19 (using the term metonymically to stand for the virus that causes the disease).
So the question now becomes. Would DARPA, whose job it is to fund Advanced Research Projects to give the US a strategic advantage over its competitors in all areas of human conflict, have said to Peter Daszak: Sorry old chap. We are not interested in your bioweapon because it is just too dangerous for us! But we do know you have a lot of dealings with Wuhan. So why not try the Chinese with this really dangerous bioweapon you are proposing to make? Maybe you will have better luck with them? I cannot imagine anything more implausible.
Their reasons for rejection
were essentially...
Gain of Function concern
Dual Use Research of Concern
Vaccine epitope coverage (immunity would be too narrow being restricted only to the spike protein - yes indeed! - they were worried that the vaccines would not work since their immunity would be too specific!)
Regulatory requirements
ELSI (ethical, legal, and social issues)
Data Usage
In other words: They rejected his application because he presented it in the wrong typeface (in biological terms).
It is clear from the events immediately following the official rejection that the project was funded extremely quickly in a clandestine way. Because for an unfunded project it was singularly successful, in a very short period of time!
So it was classified. That is why DARPA outwardly rejected it. So the US deep state essentially employed Peter Daszak and the EcoHealth Alliance to make Covid-19 for US covert operations.
It is also apparent that it was funded AND produced in a clandestine way because Peter Daszak arranged for a letter to be written to the Lancet by 27 academics on 2020February19 calling all scientists who rejected a natural origin for Covid-19 conspiracy theorists. Whereas the true conspiracy theory was that there was any way it could have come from nature...
"The rapid, open, and transparent sharing of data on this outbreak is now being threatened by rumours and misinformation around its origins. We stand together to strongly condemn conspiracy theories suggesting that COVID-19 does not have a natural origin. Scientists from multiple countries have published and analysed genomes of the causative agent, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and they overwhelmingly conclude that this coronavirus originated in wildlife, as have so many other emerging pathogens.
This is further supported by a letter from the presidents of the US National Academies of Science, Engineering, and Medicine and by the scientific communities they represent. Conspiracy theories do nothing but create fear, rumours, and prejudice that jeopardise our global collaboration in the fight against this virus. We support the call from the Director-General of WHO to promote scientific evidence and unity over misinformation and conjecture. We want you, the science and health professionals of China, to know that we stand with you in your fight against this virus.
We invite others to join us in supporting the scientists, public health professionals, and medical professionals of Wuhan and across China. Stand with our colleagues on the frontline!
We speak in one voice. To add your support for this statement, sign our letter online. LM is editor of ProMED-mail. We declare no competing interests."
- https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext
That letter is not the wording of a scientist. It is the wording of an intelligence operative, a lying manipulator, a deceiver, a slanderer.
The Lancet panel investigating the lab leak versus natural origin theories was disbanded by its chairman Jeffrey Sachs on Saturday 2021September25, over its ties to Peter Daszak. https://www.dailymail.co.uk/news/article-10028443/Lancets-COVID-origins-panel-disbands-ties-Peter-Daszaks-EcoHealth-Alliance.html
What interest would Peter Daszak have in dishonestly trying to discredit the man made Covid-19 origin theory in Britain's premier medical journal unless he or his EcoHealth Alliance was involved in the making of it?
So we have a guy who submits a proposal to DARPA in 2018 to make the virus behind Covid-19 in precisely the way that it appeared in 2019, and in a way that nature could not possibly have made it (with the double CGG codon in the furin cleavage site which exists in no other virus and which exits in no other SARS type virus at the S1/S2 junction) and then that same man manufactures a fraudulent letter to the Lancet, Britain's premier medical journal, trashing the man made origin theory and declaring he has no competing interests!
He obviously did make it. Which means that DARPA's rejection was cosmetic and designed to throw people off the scent. Which means that the US deep state did fund it. Which means that Covid19 it is a US bioweapon as are its vaccines.
I mean would the people who funded more than a dozen SECRETIVE biolabs in Ukraine really reject a bioweapon from Peter Daszak? Or would they overtly reject it whilst secretly accepting it?
Richard Ebright, a molecular biologist at Rutgers University who has espoused the possibility that SARS-CoV-2 may have originated in a lab, agreed. “The relevance of this is that SARS Cov-2, the pandemic virus, is the only virus in its entire genus of SARS-related coronaviruses that contains a fully functional cleavage site at the S1, S2 junction,” said Ebright, referring to the place where two subunits of the spike protein meet. “And here is a proposal from the beginning of 2018, proposing explicitly to engineer that sequence at that position in chimeric lab-generated coronaviruses.” - https://theintercept.com/2021/09/23/coronavirus-research-grant-darpa/
But the treachery of the US deep state did not stop at the virus. This is an intelligence exercise. Its purpose is a little more far reaching than giving mankind a slightly more lethal version of the flu. This is where Moderna, the NIH under Francis Collins (now resigned) and the NIAID under Fauci (presently resigning) come in. For the purpose of the virus was to enable the vaccine mandates (after the deep state had gained control of the regulators and enough of the politicians). This is another sign of an intelligence operation. For Colby famously said at the time of Watergate...
"The CIA owns everyone of any significance in the major media" (William Colby 1920 - 1996 - director of the CIA). He said this during the extraordinarily successful Watergate cover up involving a full and total failure of the US security services, from 1973-1976. We know that the words of Colby were true (notwithstanding the plethora of intelligence agency inspired websites dishonestly proclaiming the opposite) because that cover up worked other than in the cases of Woodward and Bernstein, who were not at the time considered to be persons of any significance in the major media.
And just as they owned every person of significance in the main stream media back then. So do they own them all today I fear. Except that they have added to that ownership every person of any significance in Pharmaceutical regulation, because that is how they operated back then and that is how they operate today.
The most pathogenic part of the virus was the spike protein, indeed that is where the humanised furin cleavage site was inserted. So they made a vaccine which produces far more spikes in your body than a full blown Covid-19 infection. And they made the vaccinated spikes last for months and months (rather than the 7-14 days of a Covid-19 infection) either by permanently adding to your cell DNA with Astra Zeneca or J&J adenoviruses or by infecting your cells with with 'stabilised' i.e. perpetual RNA, which they innocently called modified RNA, but which is in fact hacking RNA which hides the fact that it is genetic material from your cells (using N1 Methyl Pseudouridine, a fake form of Uracil, one of the 4 bases of RNA). This hacking RNA therefore becomes an email to your cell ribosomes which cannot be deleted and just goes on instructing them to make more and more and more and more spikes, until either the cell dies, or is killed by your T cells. That is if the spikes do not themselves infect your T cells first before they can do their job.
So any disease that the medical media or the main stream media says is caused by Covid-19 spikes is caused to a much larger extent by the vaccines which, are turbo Covid-19 as regards spike production.
These spikes do not only affect your heart, your central nervous system, your body organs, your immune system and your reproductive system. They affect your state of mind.
"Among 236,379 patients diagnosed with COVID-19, the estimated incidence of a neurological or psychiatric diagnosis in the following 6 months was 33·62%" - https://www.thelancet.com/journals/lanpsy/article/PIIS2215-0366(21)00084-5/fulltext
Of course, the paper did NOT specify how many of these patients had been vaccinated (had it done so it would never have been published or funded). But we know from the Exposé that 9 out of 10 hospitalised patients are fully vaccinated (whatever that means these days). So these spike proteins (be it from the virus or more so from the vaccine) are causing significant damage to the brain.
Dr. Stephanie Seneff is a senior research scientist at MIT, where she has had a continuous affiliation for more than five decades. She has four advanced degrees from MIT, including a B.S. in Biophysics, an M.S., E.E., and a Ph.D. in Electrical Engineering and Computer Science. She has been predicting neurodegenerative disease from spike proteins since 2021.
I have anecdotally experienced this with vaccinated people whom I have known for a long time becoming more destructive than I have ever seen them before after a few drinks. I am beginning to think that alcohol and Vaccines do not mix.
I would be interested to know if any other readers have seen this? When I have spoken to friends they have confirmed similar behaviour. Drunken vaccinees become unreasonable, anempathetic, destructive, aggressive, dishonest, and absurdly negative. I mean more so than a bad alcoholic. I have seen this happening to people I love and I really do not like it.
US Government Funding for Peter Daszak and ECO Health Alliance
Government Department | Grant Value | Period |
DoD Department of Defense | $38,949,941.00 | 2013-2020 |
HHS Health & Human Services (includes NIH and CDC) | $13,023,168.00 | 2007-2020 |
National Science Foundation | $2,590,418.00 | 2006-2020 |
USAID US Agency for International Development | $2,499,147.00 | 2013-2016 |
DHS Department of Homeland Security | $2,272,813 | 2016-2019 |
DoC Department of Commerce | $1,241,933.00 | 2006-2010 |
USDA US Department of Agriculture | $646,701.00 | 2007-2009 |
DoI Department of the Interior | $267,062.00 | 2004-2014 |
Total | $61,491,183 | 2004-2020 |
US government Funding of the Wuhan Institute of Virology
The Wuhan lab got a $3.7 million grant from the US government approved by Obama running over 4 years from 2015 to 2019. - https://www.snopes.com/fact-check/obama-admin-wuhan-lab-grant/
Fauci also gave them $3.7 million from the NIAID (National Institute of Allergy and Infectious Diseases) - In 2019, with the backing of NIAID, the National Institutes of Health committed $3.7 million over six years for research that included some gain-of-function work. The program followed another $3.7 million, 5-year project for collecting and studying bat coronaviruses, which ended in 2019, bringing the total to $7.4 million. - https://www.newsweek.com/dr-fauci-backed-controversial-wuhan-lab-millions-us-dollars-risky-coronavirus-research-1500741
"The controversy was such that it led to a Congressional moratorium on chimeric research in the USA. At which point, Dr. Antonio Fauci diverted 3.7 Million U.S. Dollars of U.S. Taxpayer monies to the Wuhan Institute of Virology to continue the research.
Rudy Giuliani, legal counsel to U. S. President Donald Trump, and former Mayor of New York city, recently demanded an explanation from Dr. Fauci for this transfer, which violated U.S. Laws against funding the research.
In addition to the research done at Chapel Hill, North Carolina, the specific kind of research into Coronaviruses as possible biological warfare agents, was being done at Fort Detrick, Maryland, USA, by the U. S. Army, which has a Level 3 and 4 Biowarfare Lab at the military base. This lab was cited by the U.S. Center for Disease Control and Prevention (CDC) in July, 2019 for failure to maintain proper containment standards"
- https://www.from rome.info/tag/fort-detrick/ (remove the space from the link)
NIAID and NIGMS Funding of Ralph S. Baric at the University of North Carolina Chapel Hill
2001 May1: https://grantome.com/grant/NIH/R01-GM063228-03
$1,007,735 over 4 years from 2001 to 2004
NIGMS (National Institute of General Medical Sicences)
Reverse Genetics with A Coronavirus Infectious Construct
Baric, Ralph S.
University of North Carolina Chapel Hill
2004 February15: https://grantome.com/grant/NIH/R01-AI059136-01
$1.402,316 million over 5 years from 2004 to 2008.
Reverse Genetics
Baric, Ralph S.
University of North Carolina Chapel Hill
Aim 1, we will develop a full length SARS cDNA clone and compare the phenotype of rescued molecular cloned viruses with wildtype using biochemical assays and macaque challenge experiments.
Aim 2, we will develop high titer SARS single hit replicons for use as expression vectors and vaccines.
Aim 3, we will select for SARS host range mutants that replicate in murine (mouse and rat) cells, identify the mechanism of SARS cross species transmission using reverse genetic approaches and evaluate the pathogenicity of these viruses in rodents and non human primates. The goal of this application is to establish genetic control over the SARS genome and provide uniform reagents that will be used by other groups throughout the country.
2004 May15: https://grantome.com/grant/NIH/R01-AI061819-01
$367,042 for 2004
Remodeling SARS Coronavirus Genome Regulatory Networks
Baric, Ralph S.
University of North Carolina Chapel Hill
2005 May1: https://grantome.com/grant/NIH/P01-AI059443-01A1
$1,676,513 for 2005
Developing Vaccine Candidates for the SARS Coronavirus
Baric, Ralph S.
University of North Carolina Chapel Hill
Total NIAID funding for Ralph Baric at University of North Carolina was $46,958,414. (https://grantome.com all grants to Baric, Ralph)
Year | Grant |
2000 | 201,232 |
2001 | 455,041 |
2002 | 253,321 |
2003 | 902,719 |
2004 | 1,628,345 |
2005 | 3,277,688 |
2006 | 3,262,315 |
2007 | 3,315,802 |
2008 | 3,539,843 |
2009 | 4,273,858 |
2010 | 1,877,793 |
2011 | 1,703,273 |
2012 | 6,871,244 |
2013 | 8,985,633 |
2014 | 1,404,641 |
2015 | 222,637 |
2016 | 1,368,161 |
2017 | 3,414,868 |
Total | 46,958,414 |
Dr David Martin - https://www.davidmartin.world/wp-content/uploads/2021/01/The_Fauci_COVID-19_Dossier.pdf
(not entirely accurate)
https://21a86421-c3e0-461b-83c2-cfe4628dfadc.filesusr.com/ugd/659775_6f632cc8d75d4d8c8b90cc749262f4b4.pdf
Richard Flemming (comprehensive).
www.lordswitnesses.net/downloads/Flemming.pdf
Richard Flemming (comprehensive).
https://www.webmd.com/lung/news/20030411/sars-timeline-of-outbreak
(detailed)
We are being asked to believe that
The DoD (Department of Defense)
The HHS Health & Human Services (includes NIH and CDC)
The NIAID
The National Science Foundation
The USAID (US Agency for International Development)
The DHS (Department of Homeland Security)
The DoC (Department of Commerce)
The USDA (US Department of Agriculture)
The DoI (Department of the Interior)
All funded Peter Daszak and the EcoHealth Alliance. But DARPA, a weapons funding outfit, refused to fund him because his work was too dangerous? Too dangerous? The USDA funded it!
No way is that true. DARPA refused because if they had openly funded Peter Daszak, then his exploits would have looked like what they were - bioweapon production.
What happened here was that the regular government departments funded him until he had a shot at a serious weapon. At that point he of course went to DARPA, because he knew his product had genocidal capability. DARPA saw that the potential was too great for overt funding. So they sent him down the covert funding route. That way they could pretend it was NOT a weapon. If DARPA had overtly funded it, we would all know that it was a bioweapon. WHICH IT IS.
As a final piece of evidence I must point out that Fort Detrick in Maryland is the centre of US bio weapons production.
On August 7th, 2019, its deadly germ research operations were abruptly shutdown following serious safety violations, in particular relating to the disposal of dangerous materials - https://en.wikipedia.org/wiki/Fort_Detrick
The CDC issued a Cease and Desist to Fort Detrick on 2019July15. The lab put all research on hold on August2 and was shut down on 2019August7 according to Fredericknewspost.com reported by Heather Mongilio - https://madisonarealymesupportgroup.com/2019/08/07/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/
https://www.military.com/daily-news/2019/11/24/cdc-inspection-findings-reveal-more-about-fort-detrick-research-suspension.html
The lab reopened partially in late November 2019 and fully reopened in April 2020. The Link has now been changed, the article has been suppressed.
https://www.fredericknewspost.com/news/health/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/article_767f3459-59c2-510f-9067-bb215db4396d.html
Link does not work for EU people any more. It worked when it was first posted!
Research into deadly viruses and biological weapons at US army lab shut down over fears they could escape. Fort Detrick researchers banned from working with anthrax, Ebola and smallpox until procedures improved - https://www.independent.co.uk/news/world/americas/virus-biological-us-army-weapons-fort-detrick-leak-ebola-anthrax-smallpox-ricin-a9042641.html
So the main US bioweapons facility was conveniently out of action for the entire period that Covid-19 was appearing in Italian sewers in 2019September and in the 10 Wuhan hospitals in 2019October. What a coincidence that is! How often was Fort Detrick closed down prior to that, I wonder? It is quite amazing that whilst the entire world was debating whether or not there was a lab leak in Wuhan, the Chinese bioweapons lab, the US bioweapons lab in Maryland was actually closed down due to fear of a lab leak!
Once one understands that the entire pandemic and vaccination response was as US deep state (intelligence) operation, then everything makes sense. Moderna, the NIH, the NIAID, are all playing their role in a scheme designed to do to your genetics what Google has already done to your search results and what Microsoft and Apple have done to your computers and mobile phones and what Facebook, Twitter and Instagram have done to your social life. They have all become US Intel assets. The security services, through these global corporations, have become more powerful than the governments of the world. That is the real constitutional problem for every democracy. And even our democracies are controlled by electronic vote counting machines provided by global corporations.
Do you think that these intelligence agencies would do all the work necessary to control the media, and all the work necessary to control pharmaceutical regulation and all the work necessary to control your search results and your computers and your mobile phones and your online social life. But fail to do the work necessary to control the vote counting machines in every democracy? Is there such a thing as a 50% control freak?
The path to a Formula one drive is traditionally Go Karting, then Formula Ford, then FIA Formulas 4,3,2, then FIA Formula1. Where FIA is the Federation Internationale de l'Automobile, the regulating body of many autosporting events and a promoter of road safety around the world, having presided over the deaths of most of the Formula one drivers up until the era of Professor Sid Watkins, the Formula One Race Doctor from 1978 to 2005.
My father was offered that post in discussions with Jody Scheckter as a result of his relationship with Jackie Stewart but recommended Sid instead, because his neurosurgical background was more relevant and because Sid was more of a devotee to the sport. I remember when Dad came back from Monaco and told me: They don't even know the blood groups of the drivers! Those were the days when the life expectancy of a formula one driver was a few seasons. Fantastic progress has been made since then to the point where Max Verstappen could drive right over the head of Lewis Hamilton without injury to either party. If only that progress had indeed been transferred into regular road vehicles.
But whilst the progress in car safety has been exemplary, the progress in fair competition has not. Sadly, a sport with a history so honourable that competitors would willingly give their lives to be a part of, they deeming a death on the track to be a noble demise, has now become a lawless and dishonourable scrummage for grubby commercial success with a bent referee in charge. In short Lewis Hamilton has climbed the ladder from Formula Ford to become the Formula One World Champion 7 times only to end up stuck in Formula Fraud.
Here we have Max Verstappen, crowned as the 2021 World Champion, having been handed the deciding race by Michael Masi, the race director, as a result of a conversation between him and Jonathan Wheatley of Red Bull
" Masi essentially executed the instructions of Jonathan Wheatley (Red Bull) without any second thought over its legality or fairness. This should be sickening listening to any fan".
https://twitter.com/F1_Jordan/status/1491184614345707520
Of course the copyright holder in the audio clip (Red bull or the FIA presumably) have had it removed from twitter. But I have the transcript below.
A virtual safety car was deployed on lap 54 of 58 of the Grand Prix. At deployment Max was more than 10 seconds behind Hamilton. Masi permitted five lapped cars lapped by Hamilton but not by Verstappen to unlap themselves but no others lapped by Verstappen, resulting in there being a straight fight between the two title rivals for the championship. Max was on brand new tyres and Lewis was on old tyres. So unlapping the cars lapped by Lewis and failing to unlap the cars lapped by Max, handed the race to Max.
But be that as it may article 48 of F1’s sporting regulations was broken in two ways
1. It requires the safety car to complete one whole lap after the cars have unlapped themselves. The unlapping occured on lap 57 in Abu Dhabi. Had the safety car obeyed the regulations and completed one whole lap thereafter, the race would have ended under the safety car and Lewis would have won it.
2. It requires all lapped cars to unlap themselves during the safety laps. Not merely the ones between the driver you want to stuff and the driver you want to help.
At that race, Masi said: 'There's a requirement in the sporting regulations to wave all the lapped cars past.'
At the Nürburgring, all lapped cars were waved through, whereas in Abu Dhabi, only the five cars between Hamilton and Verstappen were moved out of the way, while other lapped cars were able to remain behind the leaders.
Here is the conversation between Red Bull's Jonathan Wheatley and the race director Michael Masi ...
Wheatley: “Obviously those lapped cars, you don’t need to let them go… right the way around and let them catch up with the back of the pack.”
Masi: “Understood.”
Wheatley: “You need to let them go…”
Masi: “Understood, just give me a second.”
Wheatley: “…and then we got a motor race on our hands.”
Masi: “Understood.”
Shortly afterwards, on lap 57, Hamilton’s engineer, Peter Bonnington, tells his driver that he believes the FIA will restart the race without the lapped cars being able to overtake. In such a scenario, with five cars between himself and Verstappen, it would have been almost impossible for the Dutchman to win the race.
Each team has a budget spending cap in order to give the less wealthy teams a better chance to compete with the super wealthy teams and make a closer and fairer race. In 2021 that cap was £145 million. If that cap is broken by any team by up to 5% (or £7.25 million), the infringement is deemed minor and the Cost Cap panel can impose a financial penalty and/or a minor sporting penalty.
The rules lay down six options that it classifies as a minor sporting penalty. These are a public reprimand, deduction of constructors’ championship points, deduction of drivers’ championship points, suspension from one or more stages of a competition (excluding the race), limitations on aerodynamic or other testing, or a reduction of the cost cap. If the cap is exceeded by above 5% the infringement is deemed material and the penalties more severe. Putting that into context, a £1 million overspend will gain you 0.2 seconds a lap, the difference between Pole position and 2nd place on the grid, winning the race or just making the top 10.
Red Bull has now been found to have broken that cap by up to 5% (a minor infringement) - and therefore essentially bought their way to the title in 2021. -
https://www.telegraph.co.uk/formula-1/2022/10/11/lack-fia-transparency-red-bull-budget-cap-breach-creating-circus/
The FIA haven't revealed by how much they broke the cap, they have only said it's a minor infringement of up to £7.25 million. If Red Bull are at the top end of that 5% then they will have gained around 1.5 seconds per lap, which gives them a huge advantage over their competitors
Max is a great F1 driver and Red Bull is a great F1 team. But there is a difference between a great man and a legend. There is a difference between a great car marque and a legendary car marque. That difference is honour. Honour results not from greatness itself but from the manner in which that greatness is achieved.
Why did so many, actually the majority of the F1 world champions prior to Ayrton Senna (who died in Sid's arms), give their lives for the sport? Why did they enter into a race knowing that it might very well be their last? Sure they enjoyed the competition. But there are plenty of competitions one can enter which do not require you to give your life - Bingo for example. Sure they enjoyed the buzz and the energy and the glory. But you can get that from crowd surfing at Glastonbury.
These people gave their lives because they trusted the competition to be fair and impartial and because they revered the legends that preceded them, who were men not only of immense skill and courage of but most of all of honour. They were men who would rather lose the race and the world championship than be seen as dishonourable chancers.
The finest example of this honour was the 1956 season finale at Monza Italy.
Going into that final race of the season, 2 time world champion and Ferrari driver, Juan Manuel Fangio had an eight-point lead over Englishman and teammate Peter Collins and the consistent Jean Behra, driving for Maserati. The only way Fangio could lose the title would be to score no points with Collins winning and setting fastest lap. (Because a driver could only count their best five scores, Behra could not win the title). In those days the rules allowed for a driver in the same team to stop and allow their teammate to drive their car. Fangio suffered a steering-arm failure toward the end of the race and had to retire, and the third Ferrari driver, Musso was unwilling to share his car with Fangio. Collins was leading and had a great chance of winning his first title. Collins, in a remarkable act of sportsmanship, instead chose to hand his Lancia-Ferrari D50 over to Fangio to allow the Argentine to finish second in the race and win his third title in a row. Collins's selfless act gained him respect from Enzo Ferrari and high praise from Fangio: "I was moved almost to tears by the gesture... Peter was one of the finest and greatest gentlemen I ever met in my racing career." Collins himself said that he was still young enough for him to win the world championship in the future. Fangio went on to win 5 world championships in total. Collins died 2 years later when he lost control of his car at the 1958 German Grand Prix at Nürburgring. Collins was never a world Champion. But he was and he is a legend in the sport.
So I call on Max Verstappen and on Christian Horner to recover the spirit in which their sport began. I call on them to do the honourable thing. I call on them to take the step from greatness into Legend and to rise above the petty glory seeking of the mass media age and prove themselves true sons of Jim Clarke, of Fangio, of Colin Chapman, of Enzo Ferrari, of Peter Collins and of all those who died with honour on the race track, having given everything they had to the sport and having taken nothing at all from it.
Why did James Hunt keep racing when he physically vomited before every single race? Surely it was because he trusted the sport. He valued the sport. He wanted to be a part of something which he recognised as noble. He wanted to add his spirit to the nobility of the sport.
I call on them to arrange a press conference with Lewis and Toto, and to CHOOSE to voluntarily give up their 2021 Driver's title and team position. The FIA have shown themselves to be institutionally corrupt just like the FIFA and every other Federation Internationale of some sport or other. They did not sack Michael Masi. They moved him sideways. Integrity in sport these days, sadly, must come from the players themselves, not the bureaucrats who run it. Just as driver safety initially came from the drivers themselves not from the FIA.
Right now Red Bull and Max Verstappen represent double cheating and dual fraud to all their sponsors. I mean to break one F1 rule and get away with it is fortunate, but to break two and get away with them both could be considered corrupt.
Yes ORACLE: Sponsors of doubly fraudulent racing cars.
ESSO: Powering one fraud after another.
MOBIL: We don't cheat our customers, but those whom we sponsor - well - hey but they win!
I should not have to say this but my mother in law could win the world championship if she was permitted to cheat. I mean she hasn't got a driving licence or anything, but if she put some tin tacks in all her competitors' tyres and had a conversation with the race director at the opportune moment, I am sure he could be persuaded to regard those little tin tacks as a minor infraction of the rules and to let the result stand - I mean that's F1 racing - right?
In short Max and Christian have a chance to be as big as the legends upon whose shoulders they stand. Events have conspired to give them this chance to win a race that is far more important than any Grand Prix and more significant than any World Championship. It is the race not to the bottom but to the top. It is a race to fix what is wrong with this world. And the people who win that race are the true legends among mankind, like the selfless Peter Collins, who honoured the sport more than he honoured himself. We need people with that type of spirit right now, not just in motorsport but in all walks of life, to set an example for us all. We need Red Bull to do this for us. Formula One needs Red Bull to do it.
And a generation that has lost its way needs Red Bull to do it in circumstances where they do not have to do it. For that is how a Champion becomes a Legend and how a Marque becomes Immortal.
I recently came across an amazing email exchange between Francis Leader and the MHRA - https://hive.blog/worldnews/@francesleader/email-exchange-with-uk-mhra-exposing-the-genomic-sequence-of-sarscov2
In this exchange the MHRA admits that as regards the Covid-19 vaccines
1. The DNA template used does not come directly from an isolated virus from an infected person
2. The DNA template (severe acute respiratory syndrome coronavirus 2 GenBank 908947.3), was generated via a combination of gene synthesis and recombinant DNA technology.
The email chain looked too good to be true. Because, in layman's terms, their admission is the smoking gun which proves that the Covid-19 pandemic was man made. SARS-CoV-2 was synthesised according to the MHRA. It was not isolated from nature. So I decided to write to the MHRA myself. Here is my email chain, a copy of which I have sent to the Expose..
From:
Sent: 30 August 2022 19:34
To: MHRA Customer Services MHRACustomerServices@mhra.gov.uk
Cc: MHRACustomerserivces@mhra.gov.uk
Subject: FOI 22/983 - Confirmation
Dear Regulators,
Can you confirm whether or not this email chain on the web between yourselves and Frances Leader about the Pfizer vaccine is genuine?
If necessary please treat this as an FOI request.
Yours gratefully
Mr Redacted
Received: 21/20/22 15:01
From: MHRA Customer Services MHRACustomerserivces@mhra.gov.uk
FOI 22/983
Dear Mr Redacted,
Thank you for your information request dated 30 August 2022.
I am pleased to provide you with some of the information requested, see below.
We confirm the email responses to Frances Leader about the Pfizer vaccine are genuine.
If you disagree with how we have interpreted the Freedom of Information Act 2000 with regards to your request, you can ask for the decision to be reviewed. The review will be carried out by a senior member of the Agency who was not involved with the original decision.
If you have a query about the information provided, please reply to this email.
Please remember to quote the reference number above in any future communications.
If you were to remain dissatisfied with the outcome of the internal review, you would have the right to apply directly to the Information Commissioner for a decision. Please bear in mind that the Information Commissioner will not normally review our handling of your request unless you have first contacted us to conduct an internal review. The Information Commissioner can be contacted at:
Information Commissioner’s Office
Wycliffe House
Water Lane
Wilmslow
Cheshire
SK9 5AF
Yours sincerely
MHRA Customer Service Centre
Medicines and Healthcare products Regulatory Agency
10 South Colonnade, Canary Wharf, London E14 4PU
The NIH GenBank database which contains all viruses known to man (other than top secret bioweapons) has 8 entries for Wuhan SARS-Cov-2. From these one can plainly see that the reference virus used for the vaccines (NC_045512.2) was not isolated from a human and was therefore computer generated. But it is great to have that confirmed by the MHRA.
Wuhan Hu1 Reference Genome: This is NC_045512.2: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome - source - not given, December 2019 (29903 nucleotides). It is identical to MN908947.3: which was submitted to the NIH on 2020January5, being the 3rd computer generated iteration as detailed below...
MN908947.1: Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome.
SOURCE: None. December 2019 (30473 nucleotides)
LOCATION: None
ONLINE: 2020January12
AUTHORS: Zhang,Y.-Z., Wu,F., Chen,Y.-M., Pei,Y.-Y., Xu,L., Wang,W., Zhao,S.,
Yu,B., Hu,Y., Tao,Z.-W., Song,Z.-G., Tian,J.-H., Zhang,Y.-L., Liu,Y., Zheng,J.-J., Dai,F.-H., Wang,Q.-M., She,J.-L. and Zhu,T.-Y.
SUBMITTED: Direct Submission: 05-JAN-2020 Department of Zoonoses, National Institute of Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Changping Liuzi 5, Beijing 102206,
China
MN908947.2: Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome
SOURCE: None. December 2019 (29875 nucleotides)
LOCATION: None
ONLINE: 2020January14
AUTHORS: Zhang,Y.-Z., Wu,F., Chen,Y.-M., Pei,Y.-Y., Xu,L., Wang,W., Zhao,S.,
Yu,B., Hu,Y., Tao,Z.-W., Song,Z.-G., Tian,J.-H., Zhang,Y.-L., Liu,Y., Zheng,J.-J., Dai,F.-H., Wang,Q.-M., She,J.-L. and Zhu,T.-Y.
SUBMITTED: Direct Submission: 05-JAN-2020. Department of Zoonoses, National Institute of Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Changping Liuzi 5, Beijing 102206,
China
MN908947.3: Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1,
complete genome
SOURCE: None. December 2019 (29903 nucleotides)
LOCATION: None
ONLINE: 2020January17
AUTHORS: Wu,F., Zhao,S., Yu,B., Chen,Y.-M., Wang,W., Hu,Y., Song,Z.-G., Tao,Z.-W.,
Tian,J.-H., Pei,Y.-Y., Yuan,M.L., Zhang,Y.-L., Dai,F.-H., Liu,Y., Wang,Q.-M.,
Zheng,J.-J., Xu,L., Holmes,E.C. and Zhang,Y.-Z.
SUBMITTED: Direct Submission: 05-JAN-2020 Shanghai Public Health Clinical Center & School of Public Health, Fudan University, Shanghai, China
MT019530: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-02/2019, complete genome.
SOURCE: Homo sapiens; female; age 49. Bronchoalveolar lavage fluid (throat swab). 30 December 2019 (29889 nucleotides)
LOCATION: Wuhan Hubei China. Latitude: 30.59 Longitude 114.3 Wuhan No 6 Hospital Pathology Department, Xianggang Rd
COLLECTED BY: Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College
ONLINE: 2020February11
AUTHORS: Ren,L., Wang,J., Jin,Q., Xiang,Z., Wu,Z., Wu,C., Liu,Y., Yang,J. and Liu,B.
SUBMITTED: Direct Submission: 04-FEB-2020 NHC Key Laboratory of Systems Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, No. 9 Dong Dan San Tiao, Dong Cheng District, Beijing
1805293611: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-01/2020, complete genome
SOURCE: Homo sapiens, male age 65. Bronchoalveolar lavage fluid (throat swab). 23 December 2019 (29899 nucleotides)
LOCATION: Wuhan Hubei China. Latitude: 30.59 Longitude 114.3 Wuhan No 6 Hospital Pathology Department, Xianggang Rd
COLLECTED BY: Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College
ONLINE: 2020February11
AUTHORS: Ren,L., Wang,J., Jin,Q., Xiang,Z., Li,Y., Wu,Z., Wu,C. and Liu,Y.
SUBMITTED: Direct Submission: 04-FEB-2020. NHC Key Laboratory of Systems Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College; Vision Medicals Co., Ltd, No. 9 Dong Dan San Tiao, Dong Cheng District, Beijing 100061, China
MT019531: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-03/2020, complete genome
SOURCE: Homo sapiens, male age 41. Bronchoalveolar lavage fluid (throat swab).
30 December 2019 (29899 nucleotides)
LOCATION: Wuhan Hubei China. Latitude: 30.59 Longitude 114.3 Wuhan No 6 Hospital Pathology Department, Xianggang Rd
COLLECTED BY: Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College
ONLINE: 2020February11
AUTHORS: Ren,L., Wang,J., Jin,Q., Xiang,Z., Wu,Z., Wu,C., Liu,Y., Yang,J. and Liu,B
SUBMITTED: Direct Submission: 04-FEB-2020. NHC Key Laboratory of Systems Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, No. 9 Dong Dan San Tiao, Dong Cheng District, Beijing 100061, China
MT019532: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-04/2020, complete genome
SOURCE: Homo sapiens, fe male age 52. Bronchoalveolar lavage fluid (throat swab).
30 December 2019 (29890 nucleotides)
LOCATION: Wuhan Hubei China. Latitude: 30.59 Longitude 114.3 Wuhan No 6 Hospital Pathology Department, Xianggang Rd
COLLECTED BY: Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College
ONLINE: 2020February11
AUTHORS: Ren,L., Wang,J., Jin,Q., Xiang,Z., Wu,Z., Wu,C., Liu,Y., Yang,J. and Liu,B.
SUBMITTED: Direct Submission: 04-FEB-2020. NHC Key Laboratory of Systems Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, No. 9 Dong Dan San Tiao, Dong Cheng District, Beijing 100061, China
MT019533: Severe acute respiratory syndrome coronavirus 2 isolate BetaCoV/Wuhan/IPBCAMS-WH-05/2020, complete genome - source - male age 61, 1 January 2020 (29883 nucleotides)
SOURCE: Homo sapiens, male age 61. Bronchoalveolar lavage fluid (throat swab).
30 December 2019 (29883 nucleotides)
LOCATION: Wuhan Hubei China. Latitude: 30.59 Longitude 114.3 Wuhan No 6 Hospital Pathology Department, Xianggang Rd
COLLECTED BY: Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College
ONLINE: 2020February11
AUTHORS: Ren,L., Wang,J., Jin,Q., Xiang,Z., Wu,Z., Wu,C., Liu,Y., Yang,J. and Liu,B.
SUBMITTED: Direct Submission: 04-FEB-2020. NHC Key Laboratory of Systems Biology of Pathogens and Christophe Merieux Laboratory, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, No. 9 Dong Dan San Tiao, Dong Cheng District, Beijing 100061, China
So the NIH database itself reveals that the original Hu1 reference strain, was not isolated from a human host because no isolation date is given and no specific person is specified as the host, and no part of the body is specified as providing the virus and no pathology lab is specified as a location in any of the 3 iterations to what became the reference coding for the vaccines.. Whereas in the other 5 entries for SARS-CoV-2 from Wuhan, a person is actually specified in the database as the source, together with a sample collection date, a body part from which it was isolated and the location for all 5 is the latitude and longitude for the pathology department of the Wuhan No 6 hospital in Xianggang Rd. So the reference strain that is used to generate every vaccine (except the Chinese and the Indian whole virus vaccines) is not from a physical virus. It is synthetic computer generated virus RNA code. For if it had been isolated from a human, then the database would describe that human and we would know which hospital pathology department processed the swab.. But it does not. Whereas the next 5 entries were isolated from a human host with ages and sexes and infected body part and path lab as above.
This is precisely what you would expect to find if a man made fast mutating (unstable VERY recently man made) virus was released and then the patients it infected had samples taken from them and sequenced.
So now we can see both from the NIH GenBank database and from the CGGCGG codon pair in the furin cleavage site on the spike protein, and from the MHRA itself that SARS-CoV-2 was man made and designed on a computer.
It is truly a testament to the influencing power of National Intelligence agencies and the corruption of most medical journals and the main stream media, that this is not universally known or accepted.
2019: Summer deletion of Wuhan Institute of Virology Corona Virus data bank.
2019 October: Glen Beck discovers evidence that 10 hospitals in Wuhan had Covid-19 cases - https://100percentfedup.com/bombshell-glenn-beck-reveals-nih-and-moderna-worked-on-mrna-vaxx-together-before-pandemic/
2019: November: University of North Carolina, Moderna and NIH began the sequencing of the 1273 amino acid spike protein vaccine (from the Wuhan Hu1 template) a month before the outbreak officially occurred. (From the interview between Dr David Martin and Reiner Fullmich)
2019 November 12: Black and Vetch sends $369,511 to Labyrinth Global Health in Ukraine for " Covid-19 Research" before Covid-19 was known or named publicly..
2019: December 31 Wuhan Municipal Health Commission report discussing COVID-19 pneumonia - deleted.
Imagine that you are Albert Bourla of Pfizer of Stéphane Bancel of Moderna and you are shocked to hear that a pandemic has begun in Wuhan caused by a pneumonia type pathogen which nobody has isolated. But fortunately 19 nice Chinese people in Beijing 655 miles away by air have designed a virus on a computer and uploaded it to the NIH database. Then they uploaded a modification. And then 17 of those 19 people plus Yuan M. L. and Holmes E. C. submitted yet another iteration of the computer generated virus code from Shanghai 429 miles away by air from Wuhan and 680 miles from Beijing. All 3 submissions occurring on the same day, 2020January5. What would be your response?
My first question would be. What relationship does your computer generated virus have with the pathogen causing the outbreak? How are they related? There is absolutely no way that question can be answered without knowing the genetic code of SARS-CoV-2. The Chinese cannot say oh we think that our computer generated virus is close enough to the pathogenic virus which we have not sequenced. The only way that question could be answered to the satisfaction of a commercial company, in the absence of the sequencing of any isolate is for the Chinese to admit that they made the virus. You cannot represent and A is near to B if you do not know where B is.
The NIH database shows that before 2020February4, the virus had not been isolated and sequenced. And we know from the double CGG codon in the furin cleavage site which does not occur in any naturally occurring virus, and from the MHRA no less, that Covid-19 was man made. So the only conversation that could have convinced the CEOs would have been: We know that this is the gene sequence of the virus because we made the virus and we released it and we caused the pandemic.
But there is no way that 19 state sponsored Chinese medics would say that. That would be the end of 19 careers right there (if not the end of their freedom). They would never be able to practice medicine again. Perhaps they could risk it under strict confidentiality conditions. But in the internet age those kind of agreements are worthless. Furthermore the Chinese deleted the entire Wuhan Institute of Virology Coronavirus Data bank in Summer 2019 and then deleted the Wuhan Municipal Health Commission report discussing Covid-19 pneumonia on 2019December31. So the Chinese state would absolutely have forbidden such a conversation. The chances of that conversation having occurred are therefore zero.
But the fact is that Moderna and Pfizer both made vaccines based on the computer generated MN908947.3. They would not have done that unless they somehow knew that the virus had that code. That information can only be known for a fact by the people who made the virus and released it. There is one golden and rather obvious law about hacking. It is this. Never leave a trail unless you have to. And if you have to then make sure it points to someone else.
It is because the virus was supplied to the NIH by the Chinese that as a hacker in another life (legally I must add) I know that it was not made in China. The Chinese laundered the genome for the true manufacturers of SARS-CoV-2, the true engineers of the Covid-19 pandemic.
Whoever did make the virus would have to have fully convinced Pfizer and Moderna that they had the correct RNA sequence of the virus or no vaccine could have been made. So without doubt, before the start of vaccine manufacture, both companies would have known that the virus was man made as confirmed to Francis Leader and myself by the MHRA, and they would have to have known who made it and who released it, causing the pandemic, in order to be sure that they had the right sequence for the vaccine.
Now Moderna has several patents on SARS vaccines which cover the present mRNA jabs. It has such confidence in those patents that it is presently suing Pfizer over them. Early in the pandemic, Moderna said it would not enforce its COVID-19 patents to help others develop their own vaccines, particularly for low and middle income countries. But in March 2022, Moderna said it expected companies such as Pfizer and BioNTech to respect its intellectual property rights. It said it would not seek damages for any activity before March 8, 2022. - https://nypost.com/2022/08/26/moderna-sues-pfizer-and-biontech-over-covid-vaccine/
Dr Malone, who invented mRNA technology, has a full mRNA vaccine patent analysis on his substack - https://rwmalonemd.substack.com/p/moderna-sues-biontechpfizer
On 2017August11 Moderna filed US 10064934B2
2017-08-11: Application filed by ModernaTx Inc
2018-09-04: Application granted
2018-09-04: Publication of US10064934B2
Their application contained the prescient words: In some embodiments, at least one antigenic polypeptide is a betacoronavirus structural protein. For example, a betacoronavirus structural protein may be spike protein (S), envelope protein (E), nucleocapsid protein (N), membrane protein (M) or an immunogenic fragment thereof. In some embodiments, a betacoronavirus structural protein is a spike protein (S). In some embodiments, a betacoronavirus structural protein is a S1 subunit or a S2 subunit of spike protein (S) or an immunogenic fragment thereof.
That wording covers every conceivable type of mRNA vaccine for a SARS type coronavirus.
Now President Voter Fraud Organisation O Bidenama at the start of his Jan6 powered presidency gave the US intelligence services the task of discovering the origins of the Covid-19 virus and asked them to report back to him within 90 days of 2021May26.
They released a report on their findings on 2021August27. Here are the wonderful words of obfuscation that they crafted...
"We judge the virus was not developed as a biological weapon. Most agencies also assess with low confidence that SARS-CoV-2 probably was not genetically engineered; however, two agencies believe there was not sufficient evidence to make an assessment either way. Finally, the IC assesses China’s officials did not have foreknowledge of the virus before the initial outbreak of COVID-19 emerged."
I guess that is what a US intelligence agency cover up looks like! Moderna and Pfizer had to know that it was genetically engineered or they could not have produced their vaccine with any certainly that it would work at all. So the US Intelligence Community also knew. The phrase "We judge the virus was not developed as a biological weapon" is an unsolicited denial. The word "Bioweapon" does not appear in Biden's brief of 2021May26. No one asked them if it was a bioweapon. They were asked to investigate its origin. They were asked to tell us where the virus came from.
Their conclusion is what they want people to believe. It is written to influence people. Not to inform people. It is the same technique that DARPA used in refusing Peter Daszak's 2018March27 DEFUSE proposal to fund the making of a virus which was precisely what ended up in the NIH database. The funding refusal occurred when the bioweapon project was classified.
So the US Intelligence community funded the bioweapon. Peter Daszak made it with some Chinese assistance. Fauci sold the response. And Moderna Patented it before any of that ever happened. And Bill Gates started pushing vaccines and depopulation, two of the results of the bioweapon, 20 years before the pandemic. What are the chances?
The Chinese were used as sub contract manufacturers (something they are exceptionally good at). And then they were persuaded to skewer themselves by providing the gene sequence of the man made US funded virus to the NIH in such a way that proves it was man made. Why did they accept that indignity? Obviously because they did a deal with the US. Moderna needed a source other than the EcoHealth Alliance of Peter Daszak and the Chinese agreed to provide it. President Xi is now ruling China with an iron first under the pretext of protecting the people from Covid-19 by implementing Zero Covid policies. In other words, the pandemic gives the Chinese authorities the power grab they desire. They acted as Patsies for the US in return for being given the pretext they needed to implement social credit score control of their people as a testing ground for the worldwide rollout.
So here we have the Chinese submitting to the NIH the very bioweapon that the NIH itself had funded and had owned a patent for since 2018 !!
2018: US Patent 7279327 for the chimeric adaption of the naturally occurring animal SARS Coronavirus to become infectious to humans targeting lung epithelial cells is transferred from University of North Carolina to he US National Institute for Health (NIH) - who funded it in the first place.
It is now known that the aim of the globalists is to force all mankind into a cashless society where every penny you own is controlled by your government rather than you, through a social credit score connected smart digital currency which in biblical terms is the Mark of the beast. The Beastmark even. The Beastcoin maybe? And we begin to see that the Chinese and the American and the British and the Australian and the Canadian and the New Zealand and the Russian and the European Intelligence services are not so far apart as they seem. They all have one common goal. And Boris and Liz could not be trusted to sell us out completely to their plan (God bless them for that). But there was one who was hungry enough for power to be trustworthy in that regard.
The plan is to force us into compliance by pandemics they design, by climate emergencies they curate, and by wars they kindle, they fan and they never extinguish. They are just like the DAs in democrat run cities. They kindle and fan the lawlessness. They never extinguish it. They seek the downfall of the United States, democrat run city by democrat run city. They are funded to abuse their power by the same people who funded Moderna to abuse our health and for the same purpose - to remove our freedom.
Dr Ryan Cole runs the largest clinical pathology lab in Idaho. - https://totalityofevidence.com/dr-ryan-cole/
Cole Diagnostics processes and reports out approximately 40,000 blood and biopsy patient samples annually. He trained at the Mayo Clinic, completing his residency in Anatomic and Clinical Pathology, as well as a fellowship in Surgical pathology, serving as chief fellow in his final year.
Ryan explains why the vaccine is more dangerous than the virus. He asks why are we being vaccinated against something that has not existed for at least 18 months? He explains how the vaccines cause VAIDS as the Expose first published over one year ago on 2021October10, on 2021October15, 2021October 23 and 2021October 27. The first piece went viral and ended up being quoted on Alex Jones through the Reese report and by President Bolsonaro of Brazil.
Well, with 12 months of hindsight we can now clearly see that Alex Jones, the Reese Report and President Bolsonaro got it right. The immune deficiency we saw statistically week on week (the vaccinated were losing ground to the unvaccinated at around 6% per week) has now manifested itself in massive increases in cancers and more aggressive wildfire cancers and higher incidences of everyday viruses and in viruses occurring at unseasonal times in demographics that they do not normally occur in..
Ryan examines cells from spike damaged people. He has given a great interview to Jan Jekielek of the Epoch Times. Here is a transcript of minutes 3:40 to 20:30. But I recommend the entire video. It brings the reader up to speed with current spike protein pathology in an understandable and charming way. This is not political science. It is not commercial science. It is medical science. It is the basis of "Informed Consent" No one should take any further vaccine shots without informing themselves of both sides of the argument in order that they can make a valid judgment rather than a brainwashed one.
No one should give or take a Covid-19 shot without watching this video: https://www.theepochtimes.com/from-wildfire-cancers-to-foot-long-clots-dr-ryan-cole-explains-the-dangers-of-the-spike-protein_4813813.html
JAN: What you are basically talking about is the immune system has been compromised somehow in people where this is happening
RYAN: Correct.
JAN: So explain that:
RYAN: So your immune system. For a simple way of thinking you have an immediate reacting arm of it and you have a slow acting arm. So your immediate is your innate immune system that's your phagocytes your dendritic cells your natural killer cells. They're the marines of the immune system. They're ready at a moment's notice. Something comes in. Attack gobble gone.
Your adaptive immune system that's what everybody [asks] oh my antibodies - what about my antibodies. That's a delayed response and the B cells become plasma cells become trained to remember. So in the future, when they encounter an infection they can ramp up an antibody response.
So they work in tandem these 2 arms of the immune system. But there are countless papers now in the literature. Fohse was one of the early ones out of the Netherlands. Fohse did a study on the Pfizer vaccine showing that these marines of the immune system were no longer reacting in the robust manner they normally do. So when an invader comes in they're ready to react. And then each unit of that system, there's little pattern recognisers. So OK you remember this and this, these little toll like receptors. You fight off this virus. You fight of that virus. You fight off this bacteria. You fight off that fungus. .So there's all these little pattern signals that the body has. Now those are down regulated too. Now the body goes. OK I have fewer marines on the front line. The ones I do have are not doing they're job and are not working. Nobody is remembering the pattern of what they are supposed to fight. So now you have a perfect storm of the ability for other infections to infect the human body.
So we saw this last year how RSV in children was out of season. And then we saw adults getting RSV and being hospitalising with Respiratory Syncytial Virus, which is usually only threatening to newborns and children under the age of 1 due to the size of their windpipe. Not just that but countless papers now talk about reactivation of shingles. There's so many upticks of shingles. There were certain papers showing the spike protein present in those shingles lesions and it's concerning because these are things that the immune system would normally say: Oh well keep that in check we'll keep that in check we'll keep that in check. But that innate, that immediate responsive are Is not as robust as its supposed to be in the majority of people that have received the shots.
Now we don't know for how that pattern is expressed in each individual. Everybody is biologically unique. So I think its prudent to say not everybody is having that thankfully. And I think a lot of people got different doses in terms of the number of doses they got as well as purity of vials, purity of injection, purity of product. That's another question we can talk about in a bit if you'd like to. But It really begs the question of: How long are these individuals going to remain in this immune suppressed state? The other critically important thing with these immune patterns that are shifted is some of the cells are the same ones that do keep cancers in check. So the reason you and I don't have cancer right now. You do, I do. She does. He does. We are sitting here. We have a handful of atypical cells every day. But because we have these surveyors, these natural killer cells shaking cells with every cell in our body. Right now you have 30 billion T cells circulating. So do I. And they're shaking hands with every cell in our body saying friend or foe, friend or foe. Mutated not mutated. And if its mutated they poke a little hole in it thrown a little hand grenade. That cell is gone and we're good. Simple as that.
But those cells are now gone in many of these individuals or weak enough that they can't do their job of keeping those cancers in check.
And that's why I keep hearing the reports. One of the reasons I keep hearing reports of wildfire cancers in many patients. And it seems to be a dose accumulated effect. The spike is dose dependent toxicity. The more spike you get, the longer the body keeps making it and the more adversely many systems are affected.
JAN: So now are we talking about spike coming from Covid or are we talking spike coming from vaccines or both?
RYAN To be fair both. But interestingly spike from a natural infection doesn't persist as long. The immune system when it encounters Covid for the first time, if you haven't had the immune suppression of the shot, you have a broad non specific response to any infection. Normally in individuals that are reasonably immune competent your body is going to clear that entire virus and spike within 7-10 days. Now personally when I had Covid back in December - I, I suffer from chronic mononucleosis -. Epstein Barr virus - from before the pandemic. And it waxes and wanes and my body keeps it in check and I do a lot of different things to try to keep it in check. But after I had Covid it got worse for a couple of weeks. So that spike protein whether from the natural infection of from the injection can do these same things.
The challenge is, when we look at the work of Dr Roltgen out of Stanford that she published in the Journal cell, that pseudouridine of the mRNA shots [which is fake form of Uracil, one of the 4 bases of RNA] doesn't get broken down in the body [like Uracil does]. So that the little message, the messenger RNA - you're making billions of messages right now for every cell in your body. And so am I. And after that message says OK you have made enough protein or enough of this for the cell, or enough of that to make that enzyme, then in minutes to hours that mRNA breaks down and stops [if made from Uracil]. These synthetic injections, Dr Roltgen in her study found [with Uracil swapped from N1 Methyl Pseudouridine], were persisting for 60 days in the lymph nodes, at least 60. At which point she stopped, so she could publish. So we know the sequences are persisting in the body for at least 60 days. But in her study they also showed that the spike protein was persisting in circulation as well and in the lymph nodes. So we know that spike protein from the injections is present for a much longer period of time. Now the nay sayers will say Oh but its such a small amount. Like yer but you can kill someone with this much cyanide and this much fentanyl. I mean, when something is toxic it's toxic. So to have spike proteins circulating in just minute levels can still trigger all these immune system harms. So from the injections we know its persisting longer.
Now some people will say what about Novavax its just a protein. But its still a spike protein. And that spike protein is a pretty high dose in Novavax. And it does have a black box warning that it can go to the heart and cause myocarditis. At higher rates than some of the other shots. They don't get an out of this either. That spike protein plain and simple is pathophysiologically toxic to the human body.
JAN: What's happened with your career, with your pathology lab - 8/9 months is a long time?.
RYAN: Its been a bumpy road. When health and wellness and life and the oath I took to a patient's on the line I won't quit what I'm doing. I've taken a lot of darts from adversarial media companies, adversarial insurance companies, adversarial hospital systems. A lot of criticism. I have had a 26 year career being a physician. Seen 500,000 patients in that career. I have yet to have one patient care complaint against me in 26 years - never had a law suit. And now all of as sudden I find myself in the crosshairs for sharing science. So because of that I lost one of my major insurance contracts. For my quote unprofessional behaviour in talking about Ivermectin and helping save a handful of lives with that for free. I never charged a patient. And then they say well gosh you're a pathologist. Well I did years of emergency medicine, years of family medicine, years of dermatology and never quit being a doctor. I am the doctor to the doctor as the laboratory physical now. So a lost a major contract there to the point that I lost a lot of employees. My business has gone down. My blood business has been affected drastically to where I am turning it over to another independent laboratory. My name is now mud in my region, even though I seem to be a folk hero in other people's eyes. I never quit being a good pathologist
I trained at the Mayo Clinic. I trained at the beast institution of the world. I've seen the weirdest cases in the world. I even had one of my friends a physician, he's like: You're a great pathologist but I have patients complaining you're not sending to him are you? Because of what the media says about me. Not because I don't have a good diagnostic skill set and a broad knowledge base. So yer I am taking it on the chin financially.
And I have invited anyone and everyone in the world. If you disagree with me bring better data. Bring better data. Crickets. 9 months ago we talked about this. Crickets 9 months later.
I 've yet to have a colleague say: You know I wanna sit down and show you where you're wrong. Because I am always willing to be wrong. That's science. Science is asking the question and testing the hypothesis and saying huh we could be right or wrong but let's prove it. But Life's been a little rougher for me. Thankfully I have some transitional things I am working on. I have become somewhat of a medical educator which I enjoy. Still writing my book. I will be doing more of an autopsy service for families around the world as I get a lot of those requests now: Was it the vaccine? Was it not the vaccine?
JAN: You know I was looking at one of your slides. The slide showed spike protein in the endothelium of blood vessels.
RYAN: And this is something that's been frustrating. In pathology for eons I mean decades and decades and decades we've had the ability to isolate proteins within cells. So any cell in your body has hundreds if not thousands of different types of proteins. And we can determine by making a very specific antibody to that protein and then we tag and little antibody to its tail and when it binds to it we know its present and on the tail of that second antibody we can put what's called a chromagen a colour and make it glow. So under the microscope we can take any tissue in the body. So like if someone has a lung cancer it will have a certain type of keratin. If someone has an ovarian cancer it will have a different type of keratin. And there's a lot of different cytoskeletal keratins in the body.
So we can stain these and have been able to do this forever in medicine. With onset of SARS-CoV-2 the spike proteins have a very specific protein shape. So you can take these proteins inject them into a hamster a rabbit a goat. They will make an antibody against it. Then you can isolate those antibodies. And now we can use those in the laboratory against very specific protein pieces. You don't even have to do the whole thing. You can just do one segment of it. Then you make it glow. Then you look at it under the scope in those vessels. These little dots. It's like everywhere that I see that colour glow now I know spike protein is present.
And so we've seen this. It's in the medical literature now. There's a necrotising encephalitis. That was the one I was showing you that had just been published in an older gentleman that passed away. His heart was also replete with spike protein as well.
And so the spike protein we can identify in any tissues where it is present or absent. And then the question becomes: Well is it from the vaccine?. Good question. We also stain for the nucleocapsid (nucleus case protein). If it were a whole viral infection both proteins would be identifiable and present in that SAME tissue. If the nucleocapsid is absent and only the spike is present then we know that it is from those persistent vaccine spike proteins that are circulating and depositing throughout the body.
JAN: So in the pathology that you have done how often is it the disease versus the vaccine spike?
RYAN: Early on we saw a lot of Covid fingers and toes. So Covid primarily was a clotting disease. Now that omicron is here its not as much of a clotting disease. We don't see the same pathophysiology with - I call it Coldvid, not Covid - that's one thing that's changed because in the majority of people it is a cold, its a common cold. The vaccine spike is still the original Wuhan spike. That's the clotting spike. The Omicron spike is not the clotting spike. So when I see individuals. Its a 20 fold-ish less clotting effect that we see from Omicron compared to say the Wuhan Alpha, the Delta, the Gamma, the earlier variants. It's just acting differently because of the mutations it's acquired. Because with that vaccine spike and the early variant spike the S1 and the S2 split off because of that little furin cleavage protein. And then the S1 circulates and becomes very inflammatory and that's what we identify in those tissues we are talking about. With Omicron that doesn't happen. And because of that now we know the vaccine is more dangerous than the virus itself. Because the vaccine still has all those pro clotting abilities, has all those inflammatory abilities. Whereas the spike from Omicron does not.
So the fact that the Wuhan spike is still present in any of the vaccines, when in circulation it went extinct more than a year and half ago now is really perplexing.
Its an extinct virus. So we're vaccinating against something that doesn't exist anymore technically. And has all risk with zero benefit. It can cause the clotting still. It can trigger those inflammatory pathways. It can get into the nucleus of our T cells we are talking about. It can get into our mitochondria and destroy our mitochondrial function that's the respiration of every cell in our body. It can bind to the ACE2 receptors on ovarian cells. It can destroy metabolic pathways to where your liver becomes fatty. It can destroy kidney capacity. It causes brain fog because it can cross the blood brain barrier. Omicron doesn't do that. It may to a tiny decree so don't quote me as saying never. Never say never. Omicron is mutating and I have reports from colleagues in the upper Midwest saying that they are seeing more pulmonary covid again. But I don't know if that's in the vaccinated individuals and not the unvaccinated. The probability is the vaccinated, based on data coming out of other countries. (3:50-20:30 minutes).
Again I advise to watch the entire video. He goes on to show how easy it is for pathologists to check for spike proteins in the cells of SADS victims. But he says most of them just do not do it. So Ryan can tell if your problems arise from the virus or from the vaccine by analysing infected cells for the spike protein and the nucleocapsid protein. The virus has the spike protein (S), the nucleocapsid protein (N: which they would have made the vaccines out of if the vaccines were about health) the membrane protein (M) and the envelope protein (E). The vaccine only has the spike protein (S). So if your cells have both the spike (S) and the nucleocapsid (N) proteins then the virus has done the damage. If they only have the spike protein (S) then the vaccine has done the damage.
Ryan explains that the more spikes you have and the longer they last, the more damage is done. So the vaccines are far more dangerous that the virus, since they expose your body to much longer lasting spikes. And even more so because the Omicron spike is 20x less pathogenic than the man made Wuhan Hu1 US intelligence services Bioweapon in every single vaccine.
Most of the biopsies presented at the FLCCC Educational Conference Orlando Florida 2022October14-16 - https://covid19criticalcare.com/conference/ - had damaged cells that expressed only spike protein, rather than other SARS-CoV-2 proteins. This suggests spike injuries are caused by vaccination and not natural infection, because in infection other SARS-CoV-2 proteins including nucleocapsid proteins are present in addition to the spike protein. - https://www.theepochtimes.com/health/covid-19-vaccine-injury-syndrome-not-a-disease-flccc-conference-shares-how-to-treat-it_4802240.html another video worth watching.
It also suggests that long Covid is in fact vaccine damage syndrome.
The Russian Sputnik V has the MN908947.3: spike protein DNA and is similar to the Astra Zeneca Vaccine but with a different viral vector for each of the two shots
The Chinese State owned SinoPharm makes the BBIBP-CorV inactivated whole virus vaccine. - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7275151/ - Really good biochemistry!
We isolated three SARS-CoV-2 strains from the bronchoalveolar lavage samples or throat swabs of three hospitalized patients from the recent COVID-19 outbreak to develop preclinical in vitro neutralization and challenge models for an inactivated SARS-CoV-2 vaccine candidate. The three strains were 19nCoV-CDC-Tan-HB02 (HB02), 19nCoV-CDC-Tan-Strain03 (CQ01), and 19nCoV-CDC-Tan-Strain04 (QD01). Notably, all of these strains were isolated from Vero cells, which have been certified by WHO for vaccine production. Vero cells, but not other cell lines, were infected via the throat swabs of patients to prevent possible mutations during viral culture and isolation.
They use beta-propiolactone which modifies the virus’s genetic material, leaving it unable to use cell machinery to replicate and therefore inactivated. So Sinopharm took a throat swab of the virus from 3 patients and tested these 3 strains of the virus for replication speed and genetic stability and antibody production etc. They chose the HB02 strain. Then they grow copies of that virus in Vero cells and inactivate them with he beta-propiolactone. The inactivated virus induces antibodies against its spike protein and its nucleocapsid protein.
So here again the spike protein is present but not the computer generated one. This seems to me to be the safest vaccine of them all. It is still no good as in introduces loads of spike proteins. But it is the least pathogenic of them all, because it is created from the whole virus rather than the pathogenic spike protein. And even more important it is not gene altering like the mRNA vaccines. There are two further inactivated whole virus vaccines...
The private Chinese company Sinovac developed CoronaVac. Here is a great explanation of how it is made and how it works
Sinovac Biotech Ltd. CoronaVac® COVID-19 Vaccine is based on an inactivated pathogen made by growing the whole virus in a lab and then killing it. CoronaVac is a 2-dose β-propiolactone-inactivated, aluminum hydroxide-adjuvanted vaccine.
A theoretical advantage of inactivated vaccines is that they contain additional viral proteins, including nucleoprotein, which could broaden protection beyond anti-spike protein responses and reduce the escape of variants from vaccine immunity. For example, a peer-reviewed study published on Nov. 24,
2021, concluded that 'CoronaVac induces higher CD4+ and CD8+ T-cell responses to the structural protein than (Pfizer-BioNTech) BNT162b2 vaccine.
Bharat Biotech and the Indian Council of Medical Research co-developed (BBV152).. Here is a great explanation of how it is made and how it works.
The trouble with all 3 of them is that they are very very close to the original man made Wuhan Hu1 US Intelligence funded bioweapon having been isolated not long after its release. And they do not work against Omicron. Which if you think about it, since they are made from the entire virus, means that neither can any vaccine based on MN908947.3 work against Omicron. So they need to be fully updated to become inactivated versions of the Omicron variant. This has been done by SinoPharm and the new Omicron targeting vaccine was cleared for clinical trials in Hong Kong on 2022April16 and then up until today - nothing?!?!?
It is now clear to me that the computer generated US intelligence funded Peter Daszak researched and designed and Fauci response organised bioweapon was released in China near the Wuhan lab or perhaps in the Wuhan lab in order to Launder its origin just as the submission of the 3x MN908947 virus genomes from Beijing and Shanghai did. But being man made and not naturally occurring, it was unstable and mutated very quickly into the strains isolated for the SinoPharm inactivated whole virus vaccine. Then it mutated and mutated until it returned to the common cold from whence it came.
Herd Immunity was reached within a year in the 1957 and 1968 Asian Flu and Hong Kong flu pandemics with nothing but Vitamin C. Had we treated Covid-19 with Vitamin C and Vitamin D, the pandemic would have finished last year.
It is vaccine immune system damage that has kept the thing going. And that just happens to be in Moderna's and in Pfizer's best interests. More importantly this pandemic has to be kept going until they can get the social credit score smart digital currency rolled out worldwide.
But the fact remains that even today, every single vaccine has the Wuhan Hu1 spike protein in it or a very very close relative. That will change if the Omicron specific SinoPharm vaccine ever finishes its clinical trials. I am guessing that will not happen until after the social credit score smart digital currency has been rolled out.
Omicron is what God or nature did to the bioweapon. He or she neutralised it. Even Bill Gates admitted that Omicron did a better job than the vaccines in ending the pandemic. But Moderna and Pfizer do not want to end the pandemic. That is why they only half updated their bivalent vaccines rather than fully updating them. I mean where would their profits come from if the pandemic ended tomorrow? Although to be fair to Pfizer, they did produce a fully updated vaccine but the CRC failed to authorise it. So this is not only about money. It is about something more. It is about control. That is the territory of the Intelligence services of the world. For they have all colluded to ensure that the citizens of their countries are continuously being infected with the pathological spike protein of an extinct bioweapon.
Dr Ryan Cole cannot understand why the bivalent vaccine still contains the Wuhan Hu1 US Intelligence Services funded bioweapon of Daszak and Fauci and Moderna, in circumstances where that spike has been extinct for at least 18 months. The reason is simple. The purpose of the entire exercise was originally and still is, to fill people up with the bioweapon. There is no vaccine which does not contain the 1273 amino acid computer generated spike (or a very close relative thereof), laundered through Wuhan, Beijing and Shanghai. But generated on a computer funded by the people who judge that it is not a bioweapon, whilst at the same time claiming to have no conclusive intelligence as to its origin.
Dr Naomi Wolf when interviewed by Mark Steyn of GBNews said:
Mark, I'm Jewish, and you know I can say this. I don't think you're going too far. I think your going exactly where you should go. It was the doctors in pre Nazi Germany in the early 30s who were co-opted by the National Socialists and sent to do exactly exactly what were seeing kind of replaying now. It was the medical organisations in the early 30s who were emboldened to be the arbiters of you know worthy of life, or unworthy of life and to kind of medicalise and pathologise dissent or difference. Um so were seeing a wholesale purchasing of the medical establishment in the United States, in Britain and in countries round the world, to do things much more serious. Let me just give one example. You brought this up and your so right. I have 3500 experts at the war room daily cloud Pfizer documents research volunteer effort. Medical experts, scientific experts going through the Pfizer documents. and indeed they are finding horrific harms against human reproduction. 360 degree harms. Who should be stepping up to announce this? The AMA. Who is announcing it? It's people like you and me, the last remaining independent journalists. But this is a scandal that the human race has never seen before - of such magnitude.
Worldwide Intelligence Services Coup
1. Get control of the microphone. The mainstream media and the mainstream internet media. (Jack Dorsey suggested that Mark Zuckerberg called his new Meta Company the "Central Intelligence Corporation").
2. Get control of the banks. (I guess that might be done with money).
3. Get control of the medical profession (by regulator mandated treatment protocols and removing practice licences of those who refuse to submit)
4. Get control of national governments (by electronic voting machines,
false opinion polls, information suppression, misinformation promotion and by paying people to cheat - that works well)
5. Get control of the people through martial law/lockdown law as a result of war, hyped environmental threats, hyped pandemic threats etc.
6. Get control of everybody's finances (by implementing social credit score controlled digital smart currencies)
7. Get control of everybody's health (by destroying their immune systems and replacing them with pharmaceutical immunity, which is only available if your social credit score is good)
My social credit score wouldn't qualify for one paracetamol. This is not the fault of Fauci, Daszak, Collins, Walenski, Trudeau, Kissinger, Putin, Xi, Obama, Blair, Bush, Gates, Zuckerberg, Schwab, or any other individual bad actor. It is the fault of the national intelligence services who have colluded to enslave us all. The individuals whom I presently condemn, have merely sold out to that collusion. We will get nowhere by attacking them. This does not get fixed until we fix our intelligence services. They are patient zero in the real pandemic affecting mankind. A pandemic of control freakery. A pandemic resulting in Slavery23 rather than Covid19.
Here we are racing to condemn our ancestors for having slaves, whilst passively presenting our shoulders to the genetic yoke of our new slave masters
But why are they doing this right now? Why have they made this agreement to enslave us by dastardly skullduggery at this particular time?
Well, it is because they are about to lose us. They are about to lose us to the next administration of mankind on earth. To the next political system for this planet. The Kingdom of God. And the more tightly they control us, the closer they are to losing us, and the closer we are to that Kingdom. Many people, Muslims and Christians and Jews, want to know when Jesus or at least the messiah, will come. He comes to release us from Slavery23 just as Moses was sent by God to release the Jews from Slavery1513Nisan14 BC in Egypt. So plainly we must be enslaved in the Egypt of this world before he can come to release us into the real promised land of the Kingdom of God - which our enslavers would deny us!
So I say to Tony Fauci, Peter Daszak, Francis Collins, Rochelle Walenski, Justin Trudeau, Henry Kissinger, Vladimir Putin, Xi Jing Ping, Barack Obama, Tony Blair, George Bush, Bill Gates, Mark Zuckerberg, Klaus Schwab are all the other Egyptians out there re-enacting the enslavement of God's people: All the Egyptians that tried to prevent that Exodus died in the red sea by the hand of God. Yet looking more positively, all those who chased after God's people were baptised in that sea by God himself (somewhat involuntarily). So chase after us by all means. But do not try and prevent us from leaving!
https://www.youtube.com/watch?v=2FmNxbkOuIA
Russell Brand revealing that twitter was stuffed full of CIA and FBI operatives.
https://kevinshipp.com/ CIA Whistleblower.
Elon Musk's new Twitter platform is hosting DiedSuddenly, a full length movie about the intravascular growths first reported by the outspoken John O'Looney a funeral director in the UK and covered by Patricia Harrity in the Expose on 2022January28. Youtube will not host the production, which is the best reference I can give for the movie. Twitter are hosting it, which is the best reference I can give for their new platform rules. Elon paid $44 billion for the privilege of using Twitter to advance scientific knowledge rather than enforce political oppression - which privilege the European Union seeks to deny him with their self serving and false definition of hate speech. So in return it is my pleasure to answer the $64 billion question: What is causing the rubbery blood clots that so many embalmers are now finding in young and middle aged people who died suddenly?
Having watched the entire movie, which although a bit gory is a most revealing and explicit testament to the damage vaccines do to the human body. I was able to put the following jigsaw together. Here are the 2 pieces of the puzzle.
1. mRNA vaccines comprise the computer generated spike protein RNA of the computer generated virus but with the Uracil base replaced by N1 Methyl Pseudouridine (m1Ψ where the m stands for Methyl, the 1 stand for N1 and the Ψ for pseudo-uridine), or fake Uracil. This indeed is the meaning of MODIFIED RNA. The RNA is modified by replacing Uracil with fake Uracil. Therefore a more appropriate name would be fRNA vaccines, FAKE RNA vaccines
I covered this in the Expose on 2022January12 in an article entitled - How the Covid-19 Vaccinated became genetically modified humans. In the section headed: The incalculable danger of immune system evading genetically modified fake RNA vaccines. I explained that regular uracil is recognised as genetic material by cell security and is degraded within a few minutes. Whereas fake Uracil is not recognised as genetic material by the immune system and therefore is not broken down and lasts for months continually instructing your cell ribosomes to make more and more spike proteins, way beyond what would be needed for vaccination purposes.
Regular messenger RNA is essentially an email between your cell nucleus (which contains your DNA) and you cell ribosomes (which make your cell proteins). The email generally says: Please make this many protein molecules and fold them up like this. After the message has been physically relayed from the cell nucleus to the ribosome by the messenger RNA, the RNA is then deleted like any email. It is thrown into the trash can.
But modified RNA, mRNA, the type used in the vaccines of Pfizer and Moderna, fRNA, fake RNA, cannot be deleted. It cannot be thrown into the trash by the cell, because it is a stealth email. It communicates with the ribosome, but is invisible to cell security. Such a thing might be quite useful in the IT world actually.
So the email just continues to instruct and reinstruct and reinstruct the cell ribosomes to make more and more spike proteins. That is bad enough. But the real problem arises when the fRNA does begin to break down a few months (rather than minutes) after cell infection. Because then the cell has all this fake Uracil lying around. I was really worried that this fake base might then find its way into other normal cell processes and start making other cell emails invisible to cell security and therefore unstoppable as well. This would manifest itself in the cell churning out a whole load of proteins that it did not need. Whenever the cell nucleus (head office) asked the ribosomes (protein factories) to make a few copies of a protein, the ribosomes would just keep churning out more and more of that protein indefinitely.
2. Looking at the rubber clots. The movie DiedSuddenly showed that they were elastic and looked and felt and behaved very much like vascular walls. They are of course found within veins and arteries. Some of the rubbery growths were almost as long as the veins in which they were found.
So let's put this 2 piece jigsaw together shall we?
What proteins do vascular wall cells make? Well unsurprisingly they make vascular wall proteins and they make whole new vascular wall cells too.
What happens if emails between their head offices and their production lines cannot be deleted because they are made from fake Uracil rather than true Uracil?
Well, they make far too much vascular wall protein and far too many vascular wall cells.
What will the cell do with unwanted excess vascular wall protein overproduction?
Evict it into the bloodstream.
What will vascular wall protein do in the blood stream? It will go around and around until it finds some more vascular wall protein which it will bind to in an attempt to build a vascular wall. Likewise with the excess vascular wall cells.
These then are what the embalmers are seeing in the blood vessels. The vascular wall cells are being instructed by undeletable protein making instructions to make way too much vascular wall protein and far too many copies of themselves. And this protein is ejected into the bloodstream and these extra cells start using these proteins to make new blood vessels within your existing blood vessels. That is what these growths are.
The body has to make some vascular wall cells to repair and replace old and damaged cells. When it tries to do that, it sends an instruction to start production to the cell ribosomes. Its mechanism for stopping production is to delete that instruction, to delete the messenger RNA email. But that mechanism does not work with modified messenger RNA, with fake messenger RNA, which cannot be deleted. So you just go on building more and more blood vessels within your blood vessels. It is rather like having a kind of vascular overproduction cancer.
What fRNA does is it turns the repair and replace workshop of your vascular system into a huge construction site, rebuilding your entire vascular system within the one you already have.
This was my worst nightmare when I first considered the effect that Pseudouridine might have after having listened to Senator Ron Johnson's Vaccine symposium in Washington: Covid-19 A Second Opinion.
These embalmers are pulling newly made blood vessels out of your pre-existing blood vessels. The fake RNA is making fake blood vessels.
I do not want to be over apocalyptic here (as I am wont to be). The human body is an amazing machine. And it has built into it all sorts of defensive capabilities which will successfully combat a lot of the damage done by these vaccines. But these veins within veins are a demonstration that the vaccines are a gene hack. They are genetic rape. And every doctor or nurse who administers them is a genetic rapist. Actually they are a genetic paedophile rapist knowing as they do that most people are too genetically or immunologically naive to give a valid consent to have their genes compromised. And even those who are not so naive have not been given both sides of the argument with equal force or at all in many cases.
Sure not everybody who is raped gets pregnant. Sometimes the fake seed they implant does not take. But other times it does and DiedSuddenly shows us one possible result. The modified or should we say perpetualised RNA does not merely reprogram your cells to make way too many spike proteins for a vaccination and for way too long. It also destroys the off button in many of your cellular processes. The effect of that is incalculably dangerous. And it is here. We know that the spike proteins infect every organ in the body and pass into the brain. Presumably they could right now be having a similar effect on those cells to the effect they are demonstrably having on the vascular wall cells. One look at those elastic vein walls being pulled out of veins and arteries and you can see that the genetics of the body have been hacked. But why would that hack be specific only to the vascular system?.
A professor of surgery once said to me that the human body is not particularly strong or powerful. Its true strength and power lies in its amazing ability to heal itself when damaged. The vaccines take away control of that delicate and precise healing capability. They weaponise it and use it against you. They turn your internal scalpel into an unstoppable chainsaw and your internal band aid dispenser into an everlasting glue gun.
Some of the reasons people adduce for giving in to vaccine pressure are:
1. I need to go on holiday
2. I need to go to university
3. I need my Job
4. I do not want to be alive if all my vaccinated friends are dead.
5. I am doing it to help everyone else
6. It is my duty as a good citizen.
7. I've tried every drug there is and I'm still here
8. I don't believe in anti vax conspiracy theories.
Let me tell you. Having one chronic life threatening illness trumps all 8 of the above. Having a chronic illness that nobody has seen before and that doctors do not want to admit even exists for fear of losing their practice licences is worse still. There is really no contest. This is a no brainer. The decision is whether you wish to be you or a malfunctioning hacked fake of you?
If my theory is correct, then only mRNA vaccinated people will exhibit these vascular growths. Non mRNA vaccines should not cause them.
I have to say one more thing. Doesn't one always? There is an MSM mantra which says: Correlation is not Causation. This is true etymologically. But it is false statistically because correlation is often due to causation. Correlation is more likely to be causation than not I would say. And if there is only one candidate for the cause of something them correlation IS causation for a fact. When you get a new global medical problem arising just after a global vaccination rollout and in the absence of any other contemporaneous global medical intervention, then the global vaccination rollout is the cause of the global medical problem by the logic of the existence and uniqueness principle.
In order to understand the timing and nature and purposes of the last war that mankind will fight, WW3, we must attempt to understand the same for the first war recorded in secular and in biblical history, that mankind fought. That war occurred 2 generations after the biblical flood of Noah of 2371Heshvan10-2370Heshvan27 BC. It resulted from the ambition of Nimrod the son of Cush the son of Ham the son of Noah, in circumstances where Ham was in the ark with his father and Cush was born to Ham and Nimrod was born to Cush after the flood. Nimrod conquered people, enslaved people, built cities and established false religious worship in his cities in the generation covering 2233Sivan BC, a biblical date for the confusing of the languages and the scattering of mankind from the Tower of Babel (2 Prophetic Times or 720 years before the law was given by Moses upon mount Sinai in Arabia on 1513Sivan7 - the Pentecost). Creation.com puts the construction of Babel as between 2245 and 2215 BC.
Nimrod is described in biblical history as...
8 And Cush begat Nimrod: he began to be a mighty one in the earth.
9 He was a mighty hunter to faces of Jehovah: wherefore it is said, Just like Nimrod [Rebel] a mighty hunter to faces of Jehovah.
10 And the beginning of his kingdom was Babel, and Erech,
and Akkad, and Calneh, in the land of Shinar. (Genesis 10 LWT)
Nimrod, meaning Rebel in Hebrew, was not a hunter of Gazelles or of Deer. H